FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623072_at:

>probe:Drosophila_2:1623072_at:380:545; Interrogation_Position=2554; Antisense; GGATCAGGCTCCAGCTCATTCTCGT
>probe:Drosophila_2:1623072_at:108:713; Interrogation_Position=2593; Antisense; TTCAGCGGAGCCTCGTCGAGCAGCA
>probe:Drosophila_2:1623072_at:340:681; Interrogation_Position=2650; Antisense; TATGGAGCTCCATCCACCGGTTCGG
>probe:Drosophila_2:1623072_at:214:431; Interrogation_Position=2782; Antisense; GAGTACAACGGACCCAGCCAGGTGC
>probe:Drosophila_2:1623072_at:550:79; Interrogation_Position=2801; Antisense; AGGTGCCCGATACCATTCAGCAGAG
>probe:Drosophila_2:1623072_at:493:117; Interrogation_Position=2824; Antisense; AGCTACAGTGCCGACGGTGGCTACA
>probe:Drosophila_2:1623072_at:55:409; Interrogation_Position=2836; Antisense; GACGGTGGCTACACCTATCGCAAGA
>probe:Drosophila_2:1623072_at:38:683; Interrogation_Position=2851; Antisense; TATCGCAAGAAGTGAGCAGCCACCG
>probe:Drosophila_2:1623072_at:462:339; Interrogation_Position=2883; Antisense; GCATACGCCACGTGCCTTCGAATAC
>probe:Drosophila_2:1623072_at:451:27; Interrogation_Position=2904; Antisense; ATACTCAACCACCACATCATATCAT
>probe:Drosophila_2:1623072_at:234:45; Interrogation_Position=2927; Antisense; ATCGCCGTCGCCATTGTAAATTATT
>probe:Drosophila_2:1623072_at:523:9; Interrogation_Position=2981; Antisense; ATTCCTCTTATACTCCTCCATGGAA
>probe:Drosophila_2:1623072_at:500:145; Interrogation_Position=2992; Antisense; ACTCCTCCATGGAAATCTAGCCTTA
>probe:Drosophila_2:1623072_at:56:643; Interrogation_Position=3007; Antisense; TCTAGCCTTAATTCACTGTACCATT

Paste this into a BLAST search page for me
GGATCAGGCTCCAGCTCATTCTCGTTTCAGCGGAGCCTCGTCGAGCAGCATATGGAGCTCCATCCACCGGTTCGGGAGTACAACGGACCCAGCCAGGTGCAGGTGCCCGATACCATTCAGCAGAGAGCTACAGTGCCGACGGTGGCTACAGACGGTGGCTACACCTATCGCAAGATATCGCAAGAAGTGAGCAGCCACCGGCATACGCCACGTGCCTTCGAATACATACTCAACCACCACATCATATCATATCGCCGTCGCCATTGTAAATTATTATTCCTCTTATACTCCTCCATGGAAACTCCTCCATGGAAATCTAGCCTTATCTAGCCTTAATTCACTGTACCATT

Full Affymetrix probeset data:

Annotations for 1623072_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720