FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623076_at:

>probe:Drosophila_2:1623076_at:441:349; Interrogation_Position=269; Antisense; GCAGGAGTTCTGACTGGCGACCAGT
>probe:Drosophila_2:1623076_at:75:143; Interrogation_Position=314; Antisense; ACTCTCTACAGGTCATGGCTTCAAA
>probe:Drosophila_2:1623076_at:726:315; Interrogation_Position=345; Antisense; GCCTGGCAGATTTTGTGATGTCCGA
>probe:Drosophila_2:1623076_at:50:621; Interrogation_Position=441; Antisense; TGCTAGCTGGTGGTCTTGTATTCAT
>probe:Drosophila_2:1623076_at:690:51; Interrogation_Position=464; Antisense; ATGCTGCCCTTCCTTATAATATTTG
>probe:Drosophila_2:1623076_at:570:413; Interrogation_Position=514; Antisense; GACCTTTACAGGTTTGCTGGTGCTA
>probe:Drosophila_2:1623076_at:265:677; Interrogation_Position=537; Antisense; TAGAAGGCACACTCCTGACCATTGT
>probe:Drosophila_2:1623076_at:629:3; Interrogation_Position=557; Antisense; ATTGTGTCCATGGTGTTCTTCGCCT
>probe:Drosophila_2:1623076_at:331:679; Interrogation_Position=594; Antisense; TAGTCATAATGGTACCTCTCTTCGG
>probe:Drosophila_2:1623076_at:127:723; Interrogation_Position=630; Antisense; TTGCTGCCTATTTCGGATTTGCCCA
>probe:Drosophila_2:1623076_at:444:19; Interrogation_Position=646; Antisense; ATTTGCCCAGGTGTATGGCCTATGT
>probe:Drosophila_2:1623076_at:262:213; Interrogation_Position=689; Antisense; AAGAGCGCGTGGGTCATGTTCTTTA
>probe:Drosophila_2:1623076_at:341:263; Interrogation_Position=744; Antisense; CAGCTGCTGTGACCATAACCGATGA
>probe:Drosophila_2:1623076_at:704:613; Interrogation_Position=766; Antisense; TGAACCCACTTCTACGACTGCATAA

Paste this into a BLAST search page for me
GCAGGAGTTCTGACTGGCGACCAGTACTCTCTACAGGTCATGGCTTCAAAGCCTGGCAGATTTTGTGATGTCCGATGCTAGCTGGTGGTCTTGTATTCATATGCTGCCCTTCCTTATAATATTTGGACCTTTACAGGTTTGCTGGTGCTATAGAAGGCACACTCCTGACCATTGTATTGTGTCCATGGTGTTCTTCGCCTTAGTCATAATGGTACCTCTCTTCGGTTGCTGCCTATTTCGGATTTGCCCAATTTGCCCAGGTGTATGGCCTATGTAAGAGCGCGTGGGTCATGTTCTTTACAGCTGCTGTGACCATAACCGATGATGAACCCACTTCTACGACTGCATAA

Full Affymetrix probeset data:

Annotations for 1623076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720