FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623081_at:

>probe:Drosophila_2:1623081_at:309:225; Interrogation_Position=405; Antisense; AAGGACTTCATATACGGCGCCAAGC
>probe:Drosophila_2:1623081_at:339:205; Interrogation_Position=430; Antisense; AAGCGCTGCAGGTAGTATCCTCAAA
>probe:Drosophila_2:1623081_at:166:303; Interrogation_Position=448; Antisense; CCTCAAAACTGATGGGCGGCGACTT
>probe:Drosophila_2:1623081_at:49:403; Interrogation_Position=468; Antisense; GACTTAGACTCCCTGGACAATCTTG
>probe:Drosophila_2:1623081_at:485:575; Interrogation_Position=503; Antisense; GGCGATCGCAGAGCTTAGACCGGTA
>probe:Drosophila_2:1623081_at:611:551; Interrogation_Position=572; Antisense; GGAGAGCGACATATACCTCAGCTTT
>probe:Drosophila_2:1623081_at:581:377; Interrogation_Position=644; Antisense; GAAGCGTTTCGTAGAGATCACCATG
>probe:Drosophila_2:1623081_at:687:655; Interrogation_Position=679; Antisense; TAATGCGTGGTCTATCCGAGATGCG
>probe:Drosophila_2:1623081_at:507:477; Interrogation_Position=762; Antisense; GTTTTCATCTGCAACTACCGTTTTG
>probe:Drosophila_2:1623081_at:603:663; Interrogation_Position=787; Antisense; TAAAGGAGTTCACCGCTGGACACCA
>probe:Drosophila_2:1623081_at:243:257; Interrogation_Position=840; Antisense; CAGTTTAGGGCCATCGACCTTATTA
>probe:Drosophila_2:1623081_at:607:293; Interrogation_Position=866; Antisense; CGAGACCATATAACATCGGCCCATG
>probe:Drosophila_2:1623081_at:381:471; Interrogation_Position=909; Antisense; GTTCGCCGACTCATAGCATATATTG
>probe:Drosophila_2:1623081_at:540:653; Interrogation_Position=937; Antisense; TAAGCCACCGCCTTCGTTGGAATAA

Paste this into a BLAST search page for me
AAGGACTTCATATACGGCGCCAAGCAAGCGCTGCAGGTAGTATCCTCAAACCTCAAAACTGATGGGCGGCGACTTGACTTAGACTCCCTGGACAATCTTGGGCGATCGCAGAGCTTAGACCGGTAGGAGAGCGACATATACCTCAGCTTTGAAGCGTTTCGTAGAGATCACCATGTAATGCGTGGTCTATCCGAGATGCGGTTTTCATCTGCAACTACCGTTTTGTAAAGGAGTTCACCGCTGGACACCACAGTTTAGGGCCATCGACCTTATTACGAGACCATATAACATCGGCCCATGGTTCGCCGACTCATAGCATATATTGTAAGCCACCGCCTTCGTTGGAATAA

Full Affymetrix probeset data:

Annotations for 1623081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720