Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623083_at:

>probe:Drosophila_2:1623083_at:83:669; Interrogation_Position=3509; Antisense; TACTTTCTGGGCCTTCTGTACATCA
>probe:Drosophila_2:1623083_at:695:201; Interrogation_Position=3557; Antisense; AACCTGGTCGACTACTTTGGCGTCA
>probe:Drosophila_2:1623083_at:200:315; Interrogation_Position=3602; Antisense; GCCATCTTCGAGCTGGTGACCATTG
>probe:Drosophila_2:1623083_at:336:511; Interrogation_Position=3617; Antisense; GTGACCATTGCCTGGATCTACGGTG
>probe:Drosophila_2:1623083_at:157:39; Interrogation_Position=3632; Antisense; ATCTACGGTGTGAAGCGACTCTGCC
>probe:Drosophila_2:1623083_at:325:643; Interrogation_Position=3651; Antisense; TCTGCCGTGACGTGGAGTTCATGAT
>probe:Drosophila_2:1623083_at:470:465; Interrogation_Position=3673; Antisense; GATTGGCATCAAGACTTCGCTGTAC
>probe:Drosophila_2:1623083_at:600:717; Interrogation_Position=3688; Antisense; TTCGCTGTACTATCGCATCTGCTGG
>probe:Drosophila_2:1623083_at:87:39; Interrogation_Position=3749; Antisense; ATCTACACCTTGGTTCTGTACGAGC
>probe:Drosophila_2:1623083_at:40:673; Interrogation_Position=3767; Antisense; TACGAGCCCCTCAAGTACAAGGATT
>probe:Drosophila_2:1623083_at:284:225; Interrogation_Position=3784; Antisense; CAAGGATTACACCTACCAATCGGGT
>probe:Drosophila_2:1623083_at:292:697; Interrogation_Position=3810; Antisense; TTTACGTTTTCGGTTGGTGCCTCAG
>probe:Drosophila_2:1623083_at:241:251; Interrogation_Position=3973; Antisense; CAAGCGGTACCAACTGTTCGTTCAG
>probe:Drosophila_2:1623083_at:43:577; Interrogation_Position=4023; Antisense; GGCGCAGCAGTATCTGGCACAAAAT

Paste this into a BLAST search page for me
TACTTTCTGGGCCTTCTGTACATCAAACCTGGTCGACTACTTTGGCGTCAGCCATCTTCGAGCTGGTGACCATTGGTGACCATTGCCTGGATCTACGGTGATCTACGGTGTGAAGCGACTCTGCCTCTGCCGTGACGTGGAGTTCATGATGATTGGCATCAAGACTTCGCTGTACTTCGCTGTACTATCGCATCTGCTGGATCTACACCTTGGTTCTGTACGAGCTACGAGCCCCTCAAGTACAAGGATTCAAGGATTACACCTACCAATCGGGTTTTACGTTTTCGGTTGGTGCCTCAGCAAGCGGTACCAACTGTTCGTTCAGGGCGCAGCAGTATCTGGCACAAAAT

Full Affymetrix probeset data:

Annotations for 1623083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime