FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623084_at:

>probe:Drosophila_2:1623084_at:302:473; Interrogation_Position=2384; Antisense; GTTAGCGCGAGCGAGTAGCTCTTTA
>probe:Drosophila_2:1623084_at:315:697; Interrogation_Position=2418; Antisense; TTATTAGCAGGTTTTTCGCTCGGCC
>probe:Drosophila_2:1623084_at:320:13; Interrogation_Position=2448; Antisense; ATTCAGTTAACCCATGTCGGCCAAG
>probe:Drosophila_2:1623084_at:337:103; Interrogation_Position=2471; Antisense; AGAGCGAGATGACAACACCACACAC
>probe:Drosophila_2:1623084_at:155:157; Interrogation_Position=2513; Antisense; ACACGCAGCTACACTCGAAATATGA
>probe:Drosophila_2:1623084_at:115:215; Interrogation_Position=2538; Antisense; AAGAGATGTCGGATGTCCCAGCAGA
>probe:Drosophila_2:1623084_at:299:443; Interrogation_Position=2549; Antisense; GATGTCCCAGCAGAAGCTATGAGTA
>probe:Drosophila_2:1623084_at:491:555; Interrogation_Position=2590; Antisense; GGAATTCACTACACAAAACGCCCAG
>probe:Drosophila_2:1623084_at:13:135; Interrogation_Position=2600; Antisense; ACACAAAACGCCCAGTATCCTTACA
>probe:Drosophila_2:1623084_at:400:23; Interrogation_Position=2704; Antisense; ATATCTAGCTATATGCATTGGGCGC
>probe:Drosophila_2:1623084_at:373:53; Interrogation_Position=2716; Antisense; ATGCATTGGGCGCAAGCAAATATTT
>probe:Drosophila_2:1623084_at:643:45; Interrogation_Position=2830; Antisense; ATCCCCGAAGGAATGTTGAGAAATA
>probe:Drosophila_2:1623084_at:273:297; Interrogation_Position=2873; Antisense; CGCGTCCCAAACCTTCAATATAGTA
>probe:Drosophila_2:1623084_at:385:683; Interrogation_Position=2906; Antisense; TTAACAACCAGATCGCGGAACGTAA

Paste this into a BLAST search page for me
GTTAGCGCGAGCGAGTAGCTCTTTATTATTAGCAGGTTTTTCGCTCGGCCATTCAGTTAACCCATGTCGGCCAAGAGAGCGAGATGACAACACCACACACACACGCAGCTACACTCGAAATATGAAAGAGATGTCGGATGTCCCAGCAGAGATGTCCCAGCAGAAGCTATGAGTAGGAATTCACTACACAAAACGCCCAGACACAAAACGCCCAGTATCCTTACAATATCTAGCTATATGCATTGGGCGCATGCATTGGGCGCAAGCAAATATTTATCCCCGAAGGAATGTTGAGAAATACGCGTCCCAAACCTTCAATATAGTATTAACAACCAGATCGCGGAACGTAA

Full Affymetrix probeset data:

Annotations for 1623084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720