Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623086_at:

>probe:Drosophila_2:1623086_at:653:625; Interrogation_Position=2634; Antisense; TGCCCGCTGCTTTAGACGTTATGAA
>probe:Drosophila_2:1623086_at:42:373; Interrogation_Position=2656; Antisense; GAAGGATTACCATCTACTCCGTGAG
>probe:Drosophila_2:1623086_at:148:145; Interrogation_Position=2671; Antisense; ACTCCGTGAGGATCTGGACTCGCTG
>probe:Drosophila_2:1623086_at:68:117; Interrogation_Position=2700; Antisense; AGCTTACATCCTGGCCCGGCAAGAA
>probe:Drosophila_2:1623086_at:714:661; Interrogation_Position=2754; Antisense; TAAAAGCCGCTTTAACGCGATCCTA
>probe:Drosophila_2:1623086_at:295:79; Interrogation_Position=2787; Antisense; AGGTTATGGCATACTCCTATTCCGC
>probe:Drosophila_2:1623086_at:584:277; Interrogation_Position=2803; Antisense; CTATTCCGCTCAAGCAGGCATCAAA
>probe:Drosophila_2:1623086_at:240:335; Interrogation_Position=2843; Antisense; GCTGCTGGAGCGGATGACGATTACT
>probe:Drosophila_2:1623086_at:88:419; Interrogation_Position=2895; Antisense; GAGCTGGTGGCCACTTATCATCAGA
>probe:Drosophila_2:1623086_at:459:179; Interrogation_Position=3008; Antisense; AAAAAGGCTACATCTTCCACGGCTT
>probe:Drosophila_2:1623086_at:618:307; Interrogation_Position=3024; Antisense; CCACGGCTTCAAAGTCTAAGGCCAA
>probe:Drosophila_2:1623086_at:657:85; Interrogation_Position=3057; Antisense; AGTGAATGCACTAACGATTTCCTAT
>probe:Drosophila_2:1623086_at:432:163; Interrogation_Position=3138; Antisense; AAATCTCATGAATGGCCGGCACTGG
>probe:Drosophila_2:1623086_at:119:579; Interrogation_Position=3161; Antisense; GGCCGACACTGTTTATACTGCTGAA

Paste this into a BLAST search page for me
TGCCCGCTGCTTTAGACGTTATGAAGAAGGATTACCATCTACTCCGTGAGACTCCGTGAGGATCTGGACTCGCTGAGCTTACATCCTGGCCCGGCAAGAATAAAAGCCGCTTTAACGCGATCCTAAGGTTATGGCATACTCCTATTCCGCCTATTCCGCTCAAGCAGGCATCAAAGCTGCTGGAGCGGATGACGATTACTGAGCTGGTGGCCACTTATCATCAGAAAAAAGGCTACATCTTCCACGGCTTCCACGGCTTCAAAGTCTAAGGCCAAAGTGAATGCACTAACGATTTCCTATAAATCTCATGAATGGCCGGCACTGGGGCCGACACTGTTTATACTGCTGAA

Full Affymetrix probeset data:

Annotations for 1623086_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime