Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623087_at:

>probe:Drosophila_2:1623087_at:400:167; Interrogation_Position=6713; Antisense; AAATGCGGACGGTACACGCTGATCC
>probe:Drosophila_2:1623087_at:147:555; Interrogation_Position=6739; Antisense; GGAGCCGCTCTATCTGGACAGATGT
>probe:Drosophila_2:1623087_at:426:153; Interrogation_Position=6756; Antisense; ACAGATGTGTCGTGTGCAGCGAAGC
>probe:Drosophila_2:1623087_at:697:261; Interrogation_Position=6772; Antisense; CAGCGAAGCGGATTGGGATGATTAT
>probe:Drosophila_2:1623087_at:186:13; Interrogation_Position=6833; Antisense; ATATTCAAAGCGGAGGACGGCGTAA
>probe:Drosophila_2:1623087_at:713:187; Interrogation_Position=6864; Antisense; AACAGTGGTACACACAGCTGCAGTA
>probe:Drosophila_2:1623087_at:365:59; Interrogation_Position=6944; Antisense; ATGATCAACGGAATGCTGGCGCGGA
>probe:Drosophila_2:1623087_at:614:243; Interrogation_Position=6985; Antisense; AATTTCCAGCTTGAAGCAGCCAGCC
>probe:Drosophila_2:1623087_at:272:125; Interrogation_Position=7006; Antisense; AGCCGTCTATCTGGCAAACGATTAG
>probe:Drosophila_2:1623087_at:457:481; Interrogation_Position=7076; Antisense; GTATTTATGCGCTATTAACCAACGA
>probe:Drosophila_2:1623087_at:292:367; Interrogation_Position=7142; Antisense; GAATCGAGCACGCATAACGCTAGTT
>probe:Drosophila_2:1623087_at:543:241; Interrogation_Position=7209; Antisense; AATACCACTACTTATACTATGCATA
>probe:Drosophila_2:1623087_at:600:53; Interrogation_Position=7227; Antisense; ATGCATAACCATACGTACACACGAA
>probe:Drosophila_2:1623087_at:697:135; Interrogation_Position=7247; Antisense; ACGAATACCCTGAACACAATGCAAT

Paste this into a BLAST search page for me
AAATGCGGACGGTACACGCTGATCCGGAGCCGCTCTATCTGGACAGATGTACAGATGTGTCGTGTGCAGCGAAGCCAGCGAAGCGGATTGGGATGATTATATATTCAAAGCGGAGGACGGCGTAAAACAGTGGTACACACAGCTGCAGTAATGATCAACGGAATGCTGGCGCGGAAATTTCCAGCTTGAAGCAGCCAGCCAGCCGTCTATCTGGCAAACGATTAGGTATTTATGCGCTATTAACCAACGAGAATCGAGCACGCATAACGCTAGTTAATACCACTACTTATACTATGCATAATGCATAACCATACGTACACACGAAACGAATACCCTGAACACAATGCAAT

Full Affymetrix probeset data:

Annotations for 1623087_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime