FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623088_at:

>probe:Drosophila_2:1623088_at:429:691; Interrogation_Position=1006; Antisense; TATTGGACAAGCATGCTCCCGAGGA
>probe:Drosophila_2:1623088_at:89:77; Interrogation_Position=1027; Antisense; AGGAGACTTCTCTGGTGGCTGCCCT
>probe:Drosophila_2:1623088_at:729:529; Interrogation_Position=1081; Antisense; GGGATCAGCTTATGATCACCCTGTC
>probe:Drosophila_2:1623088_at:102:263; Interrogation_Position=1142; Antisense; CAGCCTGTCTATCGGACGCTATGTA
>probe:Drosophila_2:1623088_at:19:577; Interrogation_Position=1178; Antisense; GGCGAAGAACAAGCCCATCTACCAT
>probe:Drosophila_2:1623088_at:138:39; Interrogation_Position=1194; Antisense; ATCTACCATCGCTTTCGGAAGCTGG
>probe:Drosophila_2:1623088_at:174:547; Interrogation_Position=1217; Antisense; GGATGAACTCTCATATCAGCTGAAA
>probe:Drosophila_2:1623088_at:279:613; Interrogation_Position=1237; Antisense; TGAAACAGCACTTGTTCCAGCCCAT
>probe:Drosophila_2:1623088_at:288:551; Interrogation_Position=1286; Antisense; GGAGATGAAGCTACAGCCCTCGCTA
>probe:Drosophila_2:1623088_at:494:593; Interrogation_Position=1312; Antisense; TGGGCCTCCCGGACGAATTGTACTT
>probe:Drosophila_2:1623088_at:195:533; Interrogation_Position=1376; Antisense; GGTGGCCAGGGTCAATAGACATCTT
>probe:Drosophila_2:1623088_at:549:401; Interrogation_Position=1393; Antisense; GACATCTTCATTTCTACAGCAAGGA
>probe:Drosophila_2:1623088_at:417:169; Interrogation_Position=1436; Antisense; AAAGGGCGGCAGAAGCTAAGCTCTT
>probe:Drosophila_2:1623088_at:629:337; Interrogation_Position=1455; Antisense; GCTCTTGTTTTAATCGAAGCCGGTT

Paste this into a BLAST search page for me
TATTGGACAAGCATGCTCCCGAGGAAGGAGACTTCTCTGGTGGCTGCCCTGGGATCAGCTTATGATCACCCTGTCCAGCCTGTCTATCGGACGCTATGTAGGCGAAGAACAAGCCCATCTACCATATCTACCATCGCTTTCGGAAGCTGGGGATGAACTCTCATATCAGCTGAAATGAAACAGCACTTGTTCCAGCCCATGGAGATGAAGCTACAGCCCTCGCTATGGGCCTCCCGGACGAATTGTACTTGGTGGCCAGGGTCAATAGACATCTTGACATCTTCATTTCTACAGCAAGGAAAAGGGCGGCAGAAGCTAAGCTCTTGCTCTTGTTTTAATCGAAGCCGGTT

Full Affymetrix probeset data:

Annotations for 1623088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720