Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623090_at:

>probe:Drosophila_2:1623090_at:163:185; Interrogation_Position=445; Antisense; AAAATGGTGCAGCTCTCAGCGCAAA
>probe:Drosophila_2:1623090_at:635:119; Interrogation_Position=462; Antisense; AGCGCAAACGTTGCCGTTATTCGTT
>probe:Drosophila_2:1623090_at:632:419; Interrogation_Position=503; Antisense; GAGCACCAGCTCTATGTGGAGCCAT
>probe:Drosophila_2:1623090_at:3:79; Interrogation_Position=554; Antisense; AGGTTGGCGACAATGTTGCCGCATT
>probe:Drosophila_2:1623090_at:563:573; Interrogation_Position=615; Antisense; GGCGGAAGTGGTGCAGTTCCTTCAC
>probe:Drosophila_2:1623090_at:449:223; Interrogation_Position=682; Antisense; AAGGATCGCCATGTGCTGAGCAAGC
>probe:Drosophila_2:1623090_at:594:421; Interrogation_Position=699; Antisense; GAGCAAGCGAAAGGTCATCCCACTG
>probe:Drosophila_2:1623090_at:53:655; Interrogation_Position=728; Antisense; TAATGCGTGCAAATCCTGAGACCGA
>probe:Drosophila_2:1623090_at:467:493; Interrogation_Position=784; Antisense; GTAATGGCGCTATATCCACAGACCA
>probe:Drosophila_2:1623090_at:629:103; Interrogation_Position=803; Antisense; AGACCACCTGTTTCTACAAGGCCAT
>probe:Drosophila_2:1623090_at:41:255; Interrogation_Position=844; Antisense; CAAACCGCCACCGAGGATTACGAGG
>probe:Drosophila_2:1623090_at:186:537; Interrogation_Position=918; Antisense; GGTCGCACAGCGCTATGTGATTGCA
>probe:Drosophila_2:1623090_at:463:63; Interrogation_Position=932; Antisense; ATGTGATTGCATATCGTCCAACGAA
>probe:Drosophila_2:1623090_at:568:353; Interrogation_Position=974; Antisense; GCAGCGGGAATCTATCATCAGCATA

Paste this into a BLAST search page for me
AAAATGGTGCAGCTCTCAGCGCAAAAGCGCAAACGTTGCCGTTATTCGTTGAGCACCAGCTCTATGTGGAGCCATAGGTTGGCGACAATGTTGCCGCATTGGCGGAAGTGGTGCAGTTCCTTCACAAGGATCGCCATGTGCTGAGCAAGCGAGCAAGCGAAAGGTCATCCCACTGTAATGCGTGCAAATCCTGAGACCGAGTAATGGCGCTATATCCACAGACCAAGACCACCTGTTTCTACAAGGCCATCAAACCGCCACCGAGGATTACGAGGGGTCGCACAGCGCTATGTGATTGCAATGTGATTGCATATCGTCCAACGAAGCAGCGGGAATCTATCATCAGCATA

Full Affymetrix probeset data:

Annotations for 1623090_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime