FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623092_at:

>probe:Drosophila_2:1623092_at:433:539; Interrogation_Position=182; Antisense; GGTATGCCTACGAGACCTCCAATGG
>probe:Drosophila_2:1623092_at:371:345; Interrogation_Position=206; Antisense; GCATTTCCGCATCGCAGGAGGGATT
>probe:Drosophila_2:1623092_at:83:667; Interrogation_Position=245; Antisense; TACAGGGCGGCAGTAGTTACACATC
>probe:Drosophila_2:1623092_at:470:675; Interrogation_Position=258; Antisense; TAGTTACACATCACCCGAGGGCGAA
>probe:Drosophila_2:1623092_at:226:603; Interrogation_Position=309; Antisense; TGAGTTTGGCTATCATCCCGTGGGC
>probe:Drosophila_2:1623092_at:608:515; Interrogation_Position=328; Antisense; GTGGGCGCACATATACCCCAGGTGC
>probe:Drosophila_2:1623092_at:204:81; Interrogation_Position=347; Antisense; AGGTGCCGGACTACATACTGCGCTC
>probe:Drosophila_2:1623092_at:520:29; Interrogation_Position=361; Antisense; ATACTGCGCTCCCTGGAGTACATTA
>probe:Drosophila_2:1623092_at:108:431; Interrogation_Position=376; Antisense; GAGTACATTAGGACGCATCCCTACC
>probe:Drosophila_2:1623092_at:700:445; Interrogation_Position=445; Antisense; GATGCAGCCGCCTTTAATGTGTACA
>probe:Drosophila_2:1623092_at:106:491; Interrogation_Position=465; Antisense; GTACACACGCAACATTCAGGATCAT
>probe:Drosophila_2:1623092_at:197:645; Interrogation_Position=585; Antisense; TCTTCCGACGCACTGATGATCGATG
>probe:Drosophila_2:1623092_at:361:43; Interrogation_Position=603; Antisense; ATCGATGGACGTGATTCTTTGGCGG
>probe:Drosophila_2:1623092_at:164:289; Interrogation_Position=650; Antisense; CGGCCAGCGGGCGAATCTGTGAATT

Paste this into a BLAST search page for me
GGTATGCCTACGAGACCTCCAATGGGCATTTCCGCATCGCAGGAGGGATTTACAGGGCGGCAGTAGTTACACATCTAGTTACACATCACCCGAGGGCGAATGAGTTTGGCTATCATCCCGTGGGCGTGGGCGCACATATACCCCAGGTGCAGGTGCCGGACTACATACTGCGCTCATACTGCGCTCCCTGGAGTACATTAGAGTACATTAGGACGCATCCCTACCGATGCAGCCGCCTTTAATGTGTACAGTACACACGCAACATTCAGGATCATTCTTCCGACGCACTGATGATCGATGATCGATGGACGTGATTCTTTGGCGGCGGCCAGCGGGCGAATCTGTGAATT

Full Affymetrix probeset data:

Annotations for 1623092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720