Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623093_at:

>probe:Drosophila_2:1623093_at:374:553; Interrogation_Position=3296; Antisense; GGAGCAGGCTCAAAACGCTGACAAA
>probe:Drosophila_2:1623093_at:677:211; Interrogation_Position=3395; Antisense; AAGACAGCTAACGAACGCCAAGCAA
>probe:Drosophila_2:1623093_at:475:159; Interrogation_Position=3466; Antisense; ACAAAAGTATAGCAGCGGCAGCCGC
>probe:Drosophila_2:1623093_at:588:397; Interrogation_Position=3545; Antisense; GACAGCAGCATCAGCGAGCATTGCA
>probe:Drosophila_2:1623093_at:105:327; Interrogation_Position=3558; Antisense; GCGAGCATTGCAACAACATCTGGAA
>probe:Drosophila_2:1623093_at:283:187; Interrogation_Position=3569; Antisense; AACAACATCTGGAAGCGGTGGAGCT
>probe:Drosophila_2:1623093_at:671:143; Interrogation_Position=3684; Antisense; ACTCCAGCCGCAAACAATGCAACTG
>probe:Drosophila_2:1623093_at:501:143; Interrogation_Position=3705; Antisense; ACTGCGGTTAGTAAGGCACCTTCTG
>probe:Drosophila_2:1623093_at:587:141; Interrogation_Position=3741; Antisense; ACGGCCAGCAGAACCGGACGCAGTA
>probe:Drosophila_2:1623093_at:213:91; Interrogation_Position=3762; Antisense; AGTACCAGCCGCCTTGACATCAGCG
>probe:Drosophila_2:1623093_at:720:401; Interrogation_Position=3777; Antisense; GACATCAGCGACATGGAATCCATTT
>probe:Drosophila_2:1623093_at:101:705; Interrogation_Position=3800; Antisense; TTATGGGTACCTAAAGCCCCGCAAG
>probe:Drosophila_2:1623093_at:309:299; Interrogation_Position=3826; Antisense; CGCGCAGCCTCAGCCTGAAGAAAAT
>probe:Drosophila_2:1623093_at:635:387; Interrogation_Position=3845; Antisense; GAAAATCCAAATACTCGACTACTAA

Paste this into a BLAST search page for me
GGAGCAGGCTCAAAACGCTGACAAAAAGACAGCTAACGAACGCCAAGCAAACAAAAGTATAGCAGCGGCAGCCGCGACAGCAGCATCAGCGAGCATTGCAGCGAGCATTGCAACAACATCTGGAAAACAACATCTGGAAGCGGTGGAGCTACTCCAGCCGCAAACAATGCAACTGACTGCGGTTAGTAAGGCACCTTCTGACGGCCAGCAGAACCGGACGCAGTAAGTACCAGCCGCCTTGACATCAGCGGACATCAGCGACATGGAATCCATTTTTATGGGTACCTAAAGCCCCGCAAGCGCGCAGCCTCAGCCTGAAGAAAATGAAAATCCAAATACTCGACTACTAA

Full Affymetrix probeset data:

Annotations for 1623093_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime