FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623094_at:

>probe:Drosophila_2:1623094_at:513:167; Interrogation_Position=1008; Antisense; AAAGGCAAACCCAATCTGTACAAAG
>probe:Drosophila_2:1623094_at:695:341; Interrogation_Position=1160; Antisense; GCTTTTTTCTCCATTATCATTACCA
>probe:Drosophila_2:1623094_at:474:493; Interrogation_Position=1223; Antisense; GTAAGAACCATAGAACACACCATTT
>probe:Drosophila_2:1623094_at:111:157; Interrogation_Position=1239; Antisense; ACACCATTTCGATCTTGTTTCTCAT
>probe:Drosophila_2:1623094_at:520:479; Interrogation_Position=1255; Antisense; GTTTCTCATCATTTTTTCAGTTGTA
>probe:Drosophila_2:1623094_at:83:283; Interrogation_Position=724; Antisense; CTCCGAGCAGGGTCTTCAAGACGGG
>probe:Drosophila_2:1623094_at:289:651; Interrogation_Position=739; Antisense; TCAAGACGGGCTGCAAGGCCGCATT
>probe:Drosophila_2:1623094_at:106:71; Interrogation_Position=754; Antisense; AGGCCGCATTCGTGAAGTATCTGGA
>probe:Drosophila_2:1623094_at:469:473; Interrogation_Position=785; Antisense; GTTACTGGTGTTCAAAATCGTCTGC
>probe:Drosophila_2:1623094_at:144:185; Interrogation_Position=798; Antisense; AAAATCGTCTGCTGGTTGCTTGTCA
>probe:Drosophila_2:1623094_at:665:283; Interrogation_Position=806; Antisense; CTGCTGGTTGCTTGTCATCGGAGAG
>probe:Drosophila_2:1623094_at:688:699; Interrogation_Position=844; Antisense; TTTTCGGTTGGCTGCTCTACAGCAG
>probe:Drosophila_2:1623094_at:582:485; Interrogation_Position=870; Antisense; GTAAAGAACCAAAGCCGCCGCAACA
>probe:Drosophila_2:1623094_at:593:297; Interrogation_Position=888; Antisense; CGCAACAATGCCGTCTGGATGTGAG

Paste this into a BLAST search page for me
AAAGGCAAACCCAATCTGTACAAAGGCTTTTTTCTCCATTATCATTACCAGTAAGAACCATAGAACACACCATTTACACCATTTCGATCTTGTTTCTCATGTTTCTCATCATTTTTTCAGTTGTACTCCGAGCAGGGTCTTCAAGACGGGTCAAGACGGGCTGCAAGGCCGCATTAGGCCGCATTCGTGAAGTATCTGGAGTTACTGGTGTTCAAAATCGTCTGCAAAATCGTCTGCTGGTTGCTTGTCACTGCTGGTTGCTTGTCATCGGAGAGTTTTCGGTTGGCTGCTCTACAGCAGGTAAAGAACCAAAGCCGCCGCAACACGCAACAATGCCGTCTGGATGTGAG

Full Affymetrix probeset data:

Annotations for 1623094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720