Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623096_a_at:

>probe:Drosophila_2:1623096_a_at:35:397; Interrogation_Position=548; Antisense; GACAAAGGAATTGGCCGGTGCCGCT
>probe:Drosophila_2:1623096_a_at:511:505; Interrogation_Position=565; Antisense; GTGCCGCTAAGTTGCTGTTTTCTTA
>probe:Drosophila_2:1623096_a_at:247:9; Interrogation_Position=602; Antisense; ATTCCATGGCATATCTGGACCCCAA
>probe:Drosophila_2:1623096_a_at:235:205; Interrogation_Position=625; Antisense; AAGCCGGCCAATGAATCGATGTGTC
>probe:Drosophila_2:1623096_a_at:499:495; Interrogation_Position=647; Antisense; GTCAGTCTCTGGAACGATTGTCCTA
>probe:Drosophila_2:1623096_a_at:184:221; Interrogation_Position=675; Antisense; AAGGGAACGCCACACGGAGTCATGT
>probe:Drosophila_2:1623096_a_at:236:41; Interrogation_Position=707; Antisense; ATCTGGACAACTGGTATCGCGAACA
>probe:Drosophila_2:1623096_a_at:195:187; Interrogation_Position=728; Antisense; AACAGTACAGCATCTTTCTTGGCGC
>probe:Drosophila_2:1623096_a_at:12:729; Interrogation_Position=746; Antisense; TTGGCGCCAGTCTAATATTGGCCAT
>probe:Drosophila_2:1623096_a_at:462:703; Interrogation_Position=778; Antisense; TTTTGTGTCCTACTCGCCATTATCA
>probe:Drosophila_2:1623096_a_at:241:15; Interrogation_Position=796; Antisense; ATTATCATGAGCTGCACCGGACTTG
>probe:Drosophila_2:1623096_a_at:702:149; Interrogation_Position=816; Antisense; ACTTGCTTCGCAACGGGCTAGGCTT
>probe:Drosophila_2:1623096_a_at:88:203; Interrogation_Position=845; Antisense; AACCTGTTCAGGAAATGCGGACTCA
>probe:Drosophila_2:1623096_a_at:83:243; Interrogation_Position=957; Antisense; AATATATCTGGGACCCGCTAGCAGA

Paste this into a BLAST search page for me
GACAAAGGAATTGGCCGGTGCCGCTGTGCCGCTAAGTTGCTGTTTTCTTAATTCCATGGCATATCTGGACCCCAAAAGCCGGCCAATGAATCGATGTGTCGTCAGTCTCTGGAACGATTGTCCTAAAGGGAACGCCACACGGAGTCATGTATCTGGACAACTGGTATCGCGAACAAACAGTACAGCATCTTTCTTGGCGCTTGGCGCCAGTCTAATATTGGCCATTTTTGTGTCCTACTCGCCATTATCAATTATCATGAGCTGCACCGGACTTGACTTGCTTCGCAACGGGCTAGGCTTAACCTGTTCAGGAAATGCGGACTCAAATATATCTGGGACCCGCTAGCAGA

Full Affymetrix probeset data:

Annotations for 1623096_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime