FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623098_at:

>probe:Drosophila_2:1623098_at:615:137; Interrogation_Position=260; Antisense; ACGAGTCCGCCATAAGTGGGTGCAC
>probe:Drosophila_2:1623098_at:311:3; Interrogation_Position=288; Antisense; ATTGGCTCTGCTGAAGCTGGATCGC
>probe:Drosophila_2:1623098_at:447:589; Interrogation_Position=305; Antisense; TGGATCGCGGCGTTACTGGCCAAAG
>probe:Drosophila_2:1623098_at:656:169; Interrogation_Position=326; Antisense; AAAGGTTTGCCATGATGCTGCCGGA
>probe:Drosophila_2:1623098_at:359:241; Interrogation_Position=361; Antisense; AATAGCACTTGGCTTTGCAACTCTC
>probe:Drosophila_2:1623098_at:195:483; Interrogation_Position=418; Antisense; GTATATATATCTGCGATGTGCCCCG
>probe:Drosophila_2:1623098_at:141:321; Interrogation_Position=437; Antisense; GCCCCGCATTCAGCATGGTGTATGA
>probe:Drosophila_2:1623098_at:145:447; Interrogation_Position=563; Antisense; GATGCCTGTGCATGACTAGCTATAC
>probe:Drosophila_2:1623098_at:411:593; Interrogation_Position=617; Antisense; TGGGCAGTCCACTCTTTTGCGATCA
>probe:Drosophila_2:1623098_at:706:433; Interrogation_Position=685; Antisense; GAGGGCTTCATGTTTTACACCAATA
>probe:Drosophila_2:1623098_at:569:437; Interrogation_Position=733; Antisense; GAGGACACCTTGAGTGGCGCAACCT
>probe:Drosophila_2:1623098_at:213:101; Interrogation_Position=766; Antisense; AGAGTCCTATGTTTTCGTCTACTTC
>probe:Drosophila_2:1623098_at:121:499; Interrogation_Position=782; Antisense; GTCTACTTCTACTTCTACTGGTGTT
>probe:Drosophila_2:1623098_at:96:503; Interrogation_Position=810; Antisense; GTCGCTTTCGGTAGTTTCATCTGAT

Paste this into a BLAST search page for me
ACGAGTCCGCCATAAGTGGGTGCACATTGGCTCTGCTGAAGCTGGATCGCTGGATCGCGGCGTTACTGGCCAAAGAAAGGTTTGCCATGATGCTGCCGGAAATAGCACTTGGCTTTGCAACTCTCGTATATATATCTGCGATGTGCCCCGGCCCCGCATTCAGCATGGTGTATGAGATGCCTGTGCATGACTAGCTATACTGGGCAGTCCACTCTTTTGCGATCAGAGGGCTTCATGTTTTACACCAATAGAGGACACCTTGAGTGGCGCAACCTAGAGTCCTATGTTTTCGTCTACTTCGTCTACTTCTACTTCTACTGGTGTTGTCGCTTTCGGTAGTTTCATCTGAT

Full Affymetrix probeset data:

Annotations for 1623098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720