FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623100_at:

>probe:Drosophila_2:1623100_at:108:213; Interrogation_Position=1305; Antisense; AAGACTTTCGAGCTAGATTGCAATA
>probe:Drosophila_2:1623100_at:374:265; Interrogation_Position=1427; Antisense; CAGACGGCACTGAAGACGACATCAA
>probe:Drosophila_2:1623100_at:717:603; Interrogation_Position=1464; Antisense; TGATCCGGGATCTATTTCATTCACC
>probe:Drosophila_2:1623100_at:594:11; Interrogation_Position=1482; Antisense; ATTCACCGCCCATATTCAAACATGA
>probe:Drosophila_2:1623100_at:644:179; Interrogation_Position=1499; Antisense; AAACATGACATTGTGCTCTCCTGGA
>probe:Drosophila_2:1623100_at:75:187; Interrogation_Position=1538; Antisense; AACAAGCTGGGCAAGCGTCATGCAC
>probe:Drosophila_2:1623100_at:250:393; Interrogation_Position=1579; Antisense; GAAAGCCGCTGCTAACGGCAAGGAT
>probe:Drosophila_2:1623100_at:705:307; Interrogation_Position=1616; Antisense; CCAGAGAAGAAATCGCGGCCATCCA
>probe:Drosophila_2:1623100_at:589:287; Interrogation_Position=1631; Antisense; CGGCCATCCAACGATCAGAAGTTTT
>probe:Drosophila_2:1623100_at:16:455; Interrogation_Position=1643; Antisense; GATCAGAAGTTTTACTCGCCGCCAT
>probe:Drosophila_2:1623100_at:118:667; Interrogation_Position=1655; Antisense; TACTCGCCGCCATCTGGAAAATACT
>probe:Drosophila_2:1623100_at:638:519; Interrogation_Position=1755; Antisense; GTGGAGGCTACAGAAACAGGCGATT
>probe:Drosophila_2:1623100_at:58:149; Interrogation_Position=1832; Antisense; ACTTCACTTGAATGGTTTGTCCCTA
>probe:Drosophila_2:1623100_at:514:479; Interrogation_Position=1846; Antisense; GTTTGTCCCTAGTCCGTAGACATAC

Paste this into a BLAST search page for me
AAGACTTTCGAGCTAGATTGCAATACAGACGGCACTGAAGACGACATCAATGATCCGGGATCTATTTCATTCACCATTCACCGCCCATATTCAAACATGAAAACATGACATTGTGCTCTCCTGGAAACAAGCTGGGCAAGCGTCATGCACGAAAGCCGCTGCTAACGGCAAGGATCCAGAGAAGAAATCGCGGCCATCCACGGCCATCCAACGATCAGAAGTTTTGATCAGAAGTTTTACTCGCCGCCATTACTCGCCGCCATCTGGAAAATACTGTGGAGGCTACAGAAACAGGCGATTACTTCACTTGAATGGTTTGTCCCTAGTTTGTCCCTAGTCCGTAGACATAC

Full Affymetrix probeset data:

Annotations for 1623100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720