Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623101_at:

>probe:Drosophila_2:1623101_at:420:159; Interrogation_Position=3022; Antisense; ACAATGTTAATTCGAAGTATCTTTT
>probe:Drosophila_2:1623101_at:317:297; Interrogation_Position=3034; Antisense; CGAAGTATCTTTTGGGTGGTTCACA
>probe:Drosophila_2:1623101_at:95:37; Interrogation_Position=3040; Antisense; ATCTTTTGGGTGGTTCACATACGTA
>probe:Drosophila_2:1623101_at:347:533; Interrogation_Position=3048; Antisense; GGTGGTTCACATACGTAAGATAAGT
>probe:Drosophila_2:1623101_at:596:177; Interrogation_Position=3078; Antisense; AAAATAAACTATTTGTCATACCACA
>probe:Drosophila_2:1623101_at:271:719; Interrogation_Position=3090; Antisense; TTGTCATACCACAAAATATGCTATG
>probe:Drosophila_2:1623101_at:172:389; Interrogation_Position=3114; Antisense; GAAAACCATTTGAAGAAGCCCCATC
>probe:Drosophila_2:1623101_at:527:373; Interrogation_Position=3125; Antisense; GAAGAAGCCCCATCAAGTGAATACT
>probe:Drosophila_2:1623101_at:353:221; Interrogation_Position=3139; Antisense; AAGTGAATACTTTTGGGCGCTAGAA
>probe:Drosophila_2:1623101_at:250:693; Interrogation_Position=3150; Antisense; TTTGGGCGCTAGAAAAACACTTTAT
>probe:Drosophila_2:1623101_at:383:377; Interrogation_Position=3161; Antisense; GAAAAACACTTTATTGTCATGGTAA
>probe:Drosophila_2:1623101_at:343:23; Interrogation_Position=3198; Antisense; ATATGTACGTTTTTGTGTGTATACA
>probe:Drosophila_2:1623101_at:631:685; Interrogation_Position=3237; Antisense; TATAGATCTGTTTTGTATGCATTCA
>probe:Drosophila_2:1623101_at:323:451; Interrogation_Position=3241; Antisense; GATCTGTTTTGTATGCATTCAATAT

Paste this into a BLAST search page for me
ACAATGTTAATTCGAAGTATCTTTTCGAAGTATCTTTTGGGTGGTTCACAATCTTTTGGGTGGTTCACATACGTAGGTGGTTCACATACGTAAGATAAGTAAAATAAACTATTTGTCATACCACATTGTCATACCACAAAATATGCTATGGAAAACCATTTGAAGAAGCCCCATCGAAGAAGCCCCATCAAGTGAATACTAAGTGAATACTTTTGGGCGCTAGAATTTGGGCGCTAGAAAAACACTTTATGAAAAACACTTTATTGTCATGGTAAATATGTACGTTTTTGTGTGTATACATATAGATCTGTTTTGTATGCATTCAGATCTGTTTTGTATGCATTCAATAT

Full Affymetrix probeset data:

Annotations for 1623101_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime