FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623102_at:

>probe:Drosophila_2:1623102_at:623:215; Interrogation_Position=409; Antisense; AAGATTCATCTAACCGCTGGACTCT
>probe:Drosophila_2:1623102_at:553:299; Interrogation_Position=492; Antisense; CGCCGATAGCCTTAGAGCCAGTAAA
>probe:Drosophila_2:1623102_at:394:309; Interrogation_Position=534; Antisense; GCCAATTAACAAGTACGCCGTGCCT
>probe:Drosophila_2:1623102_at:651:291; Interrogation_Position=552; Antisense; CGTGCCTGGCTACTACATGAATTCA
>probe:Drosophila_2:1623102_at:261:55; Interrogation_Position=568; Antisense; ATGAATTCATACTCCAAAGCCGCTG
>probe:Drosophila_2:1623102_at:283:521; Interrogation_Position=607; Antisense; GTGGCTGCGGACAACATTCAATTGC
>probe:Drosophila_2:1623102_at:133:41; Interrogation_Position=638; Antisense; ATCTGTATCACCTGCAGCATTTGCA
>probe:Drosophila_2:1623102_at:375:359; Interrogation_Position=665; Antisense; GCAACGTTTCCAAGACGCTCGAGGA
>probe:Drosophila_2:1623102_at:121:467; Interrogation_Position=702; Antisense; GATTGGACACTTTCAGATCGCCCAG
>probe:Drosophila_2:1623102_at:678:547; Interrogation_Position=747; Antisense; GGATGTTTCCGGTGAGCTGGACTAC
>probe:Drosophila_2:1623102_at:118:141; Interrogation_Position=770; Antisense; ACGGATTTGTGTTCAAGGCTCTCCA
>probe:Drosophila_2:1623102_at:690:571; Interrogation_Position=786; Antisense; GGCTCTCCAGGAATTCGGCTATGAT
>probe:Drosophila_2:1623102_at:438:725; Interrogation_Position=877; Antisense; TTGGGCTACACGCTATAATTATCAC
>probe:Drosophila_2:1623102_at:602:561; Interrogation_Position=923; Antisense; GGAACTGCTCTGCATTTATACACAT

Paste this into a BLAST search page for me
AAGATTCATCTAACCGCTGGACTCTCGCCGATAGCCTTAGAGCCAGTAAAGCCAATTAACAAGTACGCCGTGCCTCGTGCCTGGCTACTACATGAATTCAATGAATTCATACTCCAAAGCCGCTGGTGGCTGCGGACAACATTCAATTGCATCTGTATCACCTGCAGCATTTGCAGCAACGTTTCCAAGACGCTCGAGGAGATTGGACACTTTCAGATCGCCCAGGGATGTTTCCGGTGAGCTGGACTACACGGATTTGTGTTCAAGGCTCTCCAGGCTCTCCAGGAATTCGGCTATGATTTGGGCTACACGCTATAATTATCACGGAACTGCTCTGCATTTATACACAT

Full Affymetrix probeset data:

Annotations for 1623102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720