FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623103_at:

>probe:Drosophila_2:1623103_at:663:281; Interrogation_Position=319; Antisense; CTCGGCGAGGTTTACAGCTACAGCT
>probe:Drosophila_2:1623103_at:65:157; Interrogation_Position=338; Antisense; ACAGCTGCGATGTTTCCAAGCGCGA
>probe:Drosophila_2:1623103_at:521:273; Interrogation_Position=453; Antisense; CATTCTGCAGCAATCGGCCGAGGAA
>probe:Drosophila_2:1623103_at:316:165; Interrogation_Position=476; Antisense; AAATCCAGCGGGTCTTCGACGAGAA
>probe:Drosophila_2:1623103_at:517:221; Interrogation_Position=499; Antisense; AAGTGTCGTGGCCACATCATTTGCA
>probe:Drosophila_2:1623103_at:639:689; Interrogation_Position=568; Antisense; TATTGTGCCACCAAATTCGCTGTAC
>probe:Drosophila_2:1623103_at:232:673; Interrogation_Position=590; Antisense; TACGCGGTCTGATGGAGGCACTGCA
>probe:Drosophila_2:1623103_at:45:51; Interrogation_Position=614; Antisense; ATGCCGAATTACGACAGGGACCTTT
>probe:Drosophila_2:1623103_at:234:649; Interrogation_Position=638; Antisense; TCAGGGATCTGATTCGAACCACCAC
>probe:Drosophila_2:1623103_at:717:35; Interrogation_Position=664; Antisense; ATCTTTCCCTATATGACCAACACTG
>probe:Drosophila_2:1623103_at:195:251; Interrogation_Position=705; Antisense; CAAGGTGAAGTTCCCATCGATCCTG
>probe:Drosophila_2:1623103_at:390:169; Interrogation_Position=758; Antisense; AAAGGATCGTGGAGGCTCATCGCAC
>probe:Drosophila_2:1623103_at:163:453; Interrogation_Position=850; Antisense; GATCATTGCGGCCTGATGCTTAAGG
>probe:Drosophila_2:1623103_at:107:247; Interrogation_Position=868; Antisense; CTTAAGGACTTTATCGACAGCGGTG

Paste this into a BLAST search page for me
CTCGGCGAGGTTTACAGCTACAGCTACAGCTGCGATGTTTCCAAGCGCGACATTCTGCAGCAATCGGCCGAGGAAAAATCCAGCGGGTCTTCGACGAGAAAAGTGTCGTGGCCACATCATTTGCATATTGTGCCACCAAATTCGCTGTACTACGCGGTCTGATGGAGGCACTGCAATGCCGAATTACGACAGGGACCTTTTCAGGGATCTGATTCGAACCACCACATCTTTCCCTATATGACCAACACTGCAAGGTGAAGTTCCCATCGATCCTGAAAGGATCGTGGAGGCTCATCGCACGATCATTGCGGCCTGATGCTTAAGGCTTAAGGACTTTATCGACAGCGGTG

Full Affymetrix probeset data:

Annotations for 1623103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720