Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623104_at:

>probe:Drosophila_2:1623104_at:313:311; Interrogation_Position=2790; Antisense; TCCAAAACCGACAAAGTGAGAACTT
>probe:Drosophila_2:1623104_at:328:511; Interrogation_Position=2805; Antisense; GTGAGAACTTAAACTGTCCTACATA
>probe:Drosophila_2:1623104_at:688:189; Interrogation_Position=2832; Antisense; AACTTTACTTCAAATGTATTTCACT
>probe:Drosophila_2:1623104_at:79:59; Interrogation_Position=2845; Antisense; ATGTATTTCACTTTATTAATTCTAG
>probe:Drosophila_2:1623104_at:540:709; Interrogation_Position=2860; Antisense; TTAATTCTAGTATGACTTTGACTCA
>probe:Drosophila_2:1623104_at:637:403; Interrogation_Position=2873; Antisense; GACTTTGACTCATATGGTATTCAGA
>probe:Drosophila_2:1623104_at:92:581; Interrogation_Position=2887; Antisense; TGGTATTCAGATAATGGTCCAGTTC
>probe:Drosophila_2:1623104_at:93:289; Interrogation_Position=3016; Antisense; CGTGCCATTCAGGTGATTGCGGAAC
>probe:Drosophila_2:1623104_at:648:531; Interrogation_Position=3027; Antisense; GGTGATTGCGGAACCCAGCTGCAAA
>probe:Drosophila_2:1623104_at:636:119; Interrogation_Position=3043; Antisense; AGCTGCAAACTGACGCCCGATTTAT
>probe:Drosophila_2:1623104_at:608:609; Interrogation_Position=3053; Antisense; TGACGCCCGATTTATAGTTCTCCAT
>probe:Drosophila_2:1623104_at:42:321; Interrogation_Position=3057; Antisense; GCCCGATTTATAGTTCTCCATTTCT
>probe:Drosophila_2:1623104_at:32:93; Interrogation_Position=3068; Antisense; AGTTCTCCATTTCTAGGTGTGTCGA
>probe:Drosophila_2:1623104_at:529:281; Interrogation_Position=3072; Antisense; CTCCATTTCTAGGTGTGTCGATGAA

Paste this into a BLAST search page for me
TCCAAAACCGACAAAGTGAGAACTTGTGAGAACTTAAACTGTCCTACATAAACTTTACTTCAAATGTATTTCACTATGTATTTCACTTTATTAATTCTAGTTAATTCTAGTATGACTTTGACTCAGACTTTGACTCATATGGTATTCAGATGGTATTCAGATAATGGTCCAGTTCCGTGCCATTCAGGTGATTGCGGAACGGTGATTGCGGAACCCAGCTGCAAAAGCTGCAAACTGACGCCCGATTTATTGACGCCCGATTTATAGTTCTCCATGCCCGATTTATAGTTCTCCATTTCTAGTTCTCCATTTCTAGGTGTGTCGACTCCATTTCTAGGTGTGTCGATGAA

Full Affymetrix probeset data:

Annotations for 1623104_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime