FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623105_at:

>probe:Drosophila_2:1623105_at:471:369; Interrogation_Position=143; Antisense; GAAGGAAGCCCTTCATAACCGGCGG
>probe:Drosophila_2:1623105_at:187:1; Interrogation_Position=167; Antisense; GCCGTTTGAAGGGTCGTTACTATGC
>probe:Drosophila_2:1623105_at:315:475; Interrogation_Position=182; Antisense; GTTACTATGCCGATGGACTTCACTT
>probe:Drosophila_2:1623105_at:241:187; Interrogation_Position=250; Antisense; AACAAGCGCCGATTCGACGCAGAAA
>probe:Drosophila_2:1623105_at:12:397; Interrogation_Position=305; Antisense; GAAATATTGCACAAGCCGTCCGTCA
>probe:Drosophila_2:1623105_at:380:441; Interrogation_Position=334; Antisense; GATGGTTTGGCTGTTGTCGCAATCA
>probe:Drosophila_2:1623105_at:652:557; Interrogation_Position=378; Antisense; GGACAATGCGAAATCCACACCTTTG
>probe:Drosophila_2:1623105_at:111:631; Interrogation_Position=425; Antisense; TACGGGTGCCGATCGAAGACTCGAA
>probe:Drosophila_2:1623105_at:701:381; Interrogation_Position=447; Antisense; GAACGCCACTGTTTTTGGCCAATCA
>probe:Drosophila_2:1623105_at:150:513; Interrogation_Position=496; Antisense; GTGAGTCACAGGGACTTCTTCACCT
>probe:Drosophila_2:1623105_at:126:651; Interrogation_Position=560; Antisense; TCACCTGGATTGTTTTCACCGAGAC
>probe:Drosophila_2:1623105_at:569:423; Interrogation_Position=580; Antisense; GAGACTACGACTGTCACCATGTCAT
>probe:Drosophila_2:1623105_at:274:127; Interrogation_Position=595; Antisense; ACCATGTCATCCGTCTCAAAGTTTT
>probe:Drosophila_2:1623105_at:36:217; Interrogation_Position=613; Antisense; AAGTTTTGGCTGTTGCGAGACCACT

Paste this into a BLAST search page for me
GAAGGAAGCCCTTCATAACCGGCGGGCCGTTTGAAGGGTCGTTACTATGCGTTACTATGCCGATGGACTTCACTTAACAAGCGCCGATTCGACGCAGAAAGAAATATTGCACAAGCCGTCCGTCAGATGGTTTGGCTGTTGTCGCAATCAGGACAATGCGAAATCCACACCTTTGTACGGGTGCCGATCGAAGACTCGAAGAACGCCACTGTTTTTGGCCAATCAGTGAGTCACAGGGACTTCTTCACCTTCACCTGGATTGTTTTCACCGAGACGAGACTACGACTGTCACCATGTCATACCATGTCATCCGTCTCAAAGTTTTAAGTTTTGGCTGTTGCGAGACCACT

Full Affymetrix probeset data:

Annotations for 1623105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720