FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623107_at:

>probe:Drosophila_2:1623107_at:329:391; Interrogation_Position=346; Antisense; GAAAGCTCCCCTGATGGAGTTCCGT
>probe:Drosophila_2:1623107_at:649:645; Interrogation_Position=399; Antisense; TCTTCTGCTTGGAGGAACACTGCTT
>probe:Drosophila_2:1623107_at:447:643; Interrogation_Position=426; Antisense; TCTCCTCTTCATATGATCGCACTGT
>probe:Drosophila_2:1623107_at:717:105; Interrogation_Position=479; Antisense; AGAACTAACTCTATTTTCCTGCCGC
>probe:Drosophila_2:1623107_at:652:493; Interrogation_Position=509; Antisense; GTCAAGTCGTTGGAGCTGCACCACA
>probe:Drosophila_2:1623107_at:106:587; Interrogation_Position=579; Antisense; TGGACCCCAAGAGCTTCGAAGTGCT
>probe:Drosophila_2:1623107_at:123:221; Interrogation_Position=597; Antisense; AAGTGCTCAAGCATCGCAAGCTGCC
>probe:Drosophila_2:1623107_at:546:567; Interrogation_Position=637; Antisense; GGCATCGCTGAGTCCCAACAAGGGA
>probe:Drosophila_2:1623107_at:625:525; Interrogation_Position=658; Antisense; GGGAATCTACGTGTGCGGCAACAAC
>probe:Drosophila_2:1623107_at:413:61; Interrogation_Position=683; Antisense; ATGGGCTACTCCTTCAAATACGACT
>probe:Drosophila_2:1623107_at:293:61; Interrogation_Position=735; Antisense; ATGTATCTCAGGAACCATCCGCAGT
>probe:Drosophila_2:1623107_at:92:295; Interrogation_Position=787; Antisense; CGAGGTGTGTGCCATTGGATCCCAA
>probe:Drosophila_2:1623107_at:292:215; Interrogation_Position=810; Antisense; AAGATGGCAGTATCATTCTCTGGCA
>probe:Drosophila_2:1623107_at:667:231; Interrogation_Position=835; Antisense; AATGAACCCCAAACAGGCGTCTGTA

Paste this into a BLAST search page for me
GAAAGCTCCCCTGATGGAGTTCCGTTCTTCTGCTTGGAGGAACACTGCTTTCTCCTCTTCATATGATCGCACTGTAGAACTAACTCTATTTTCCTGCCGCGTCAAGTCGTTGGAGCTGCACCACATGGACCCCAAGAGCTTCGAAGTGCTAAGTGCTCAAGCATCGCAAGCTGCCGGCATCGCTGAGTCCCAACAAGGGAGGGAATCTACGTGTGCGGCAACAACATGGGCTACTCCTTCAAATACGACTATGTATCTCAGGAACCATCCGCAGTCGAGGTGTGTGCCATTGGATCCCAAAAGATGGCAGTATCATTCTCTGGCAAATGAACCCCAAACAGGCGTCTGTA

Full Affymetrix probeset data:

Annotations for 1623107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720