FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623108_at:

>probe:Drosophila_2:1623108_at:285:219; Interrogation_Position=418; Antisense; AAGTCGCGCCCAAGTACGGCAAGCG
>probe:Drosophila_2:1623108_at:406:27; Interrogation_Position=487; Antisense; ATACCCAGACTGATGCTGAGGCCGT
>probe:Drosophila_2:1623108_at:253:69; Interrogation_Position=505; Antisense; AGGCCGTTCCGCTTGGCAATGCTGA
>probe:Drosophila_2:1623108_at:126:613; Interrogation_Position=527; Antisense; TGACAAGCCCATCACGGCAGAGGAT
>probe:Drosophila_2:1623108_at:48:101; Interrogation_Position=545; Antisense; AGAGGATCTCACTAGCACAGCCGAA
>probe:Drosophila_2:1623108_at:225:295; Interrogation_Position=566; Antisense; CGAACCCGGCGAGAACTACTACAAG
>probe:Drosophila_2:1623108_at:534:585; Interrogation_Position=619; Antisense; TGGAGGACTCGCTCACCGAAAACCG
>probe:Drosophila_2:1623108_at:464:439; Interrogation_Position=680; Antisense; GATGGACACTATGCGCCAGGAACTG
>probe:Drosophila_2:1623108_at:104:557; Interrogation_Position=794; Antisense; GGACAAGGTCAACGCCTAGGCTACA
>probe:Drosophila_2:1623108_at:336:339; Interrogation_Position=813; Antisense; GCTACACACCAATCACACGTTTTTT
>probe:Drosophila_2:1623108_at:79:23; Interrogation_Position=871; Antisense; ATATCGCGTTTATATCCCTGTTCGT
>probe:Drosophila_2:1623108_at:626:601; Interrogation_Position=889; Antisense; TGTTCGTCGTCAGCCAACACAACGG
>probe:Drosophila_2:1623108_at:295:157; Interrogation_Position=907; Antisense; ACAACGGCTGGTCTAATTGTACGCC
>probe:Drosophila_2:1623108_at:317:473; Interrogation_Position=948; Antisense; GTTACACGCCAGTTATAATCCTAAT

Paste this into a BLAST search page for me
AAGTCGCGCCCAAGTACGGCAAGCGATACCCAGACTGATGCTGAGGCCGTAGGCCGTTCCGCTTGGCAATGCTGATGACAAGCCCATCACGGCAGAGGATAGAGGATCTCACTAGCACAGCCGAACGAACCCGGCGAGAACTACTACAAGTGGAGGACTCGCTCACCGAAAACCGGATGGACACTATGCGCCAGGAACTGGGACAAGGTCAACGCCTAGGCTACAGCTACACACCAATCACACGTTTTTTATATCGCGTTTATATCCCTGTTCGTTGTTCGTCGTCAGCCAACACAACGGACAACGGCTGGTCTAATTGTACGCCGTTACACGCCAGTTATAATCCTAAT

Full Affymetrix probeset data:

Annotations for 1623108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720