Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623109_at:

>probe:Drosophila_2:1623109_at:82:229; Interrogation_Position=1024; Antisense; AATGACGGTTTTAGTGCGTTAGACT
>probe:Drosophila_2:1623109_at:242:683; Interrogation_Position=642; Antisense; TATGCGTCCCTCCAGAAATCGGAGA
>probe:Drosophila_2:1623109_at:537:165; Interrogation_Position=657; Antisense; AAATCGGAGAACATGCGCACCAACT
>probe:Drosophila_2:1623109_at:559:423; Interrogation_Position=663; Antisense; GAGAACATGCGCACCAACTACGATG
>probe:Drosophila_2:1623109_at:366:279; Interrogation_Position=680; Antisense; CTACGATGCCGGCAACGAGTCGGAT
>probe:Drosophila_2:1623109_at:241:537; Interrogation_Position=701; Antisense; GGATGACTTCATGTAGTCCCCGGGT
>probe:Drosophila_2:1623109_at:78:219; Interrogation_Position=736; Antisense; AAGTCCTGGTGCACCCTCGCATTTA
>probe:Drosophila_2:1623109_at:193:341; Interrogation_Position=754; Antisense; GCATTTACCCAAAACATCCTTTGCC
>probe:Drosophila_2:1623109_at:570:409; Interrogation_Position=785; Antisense; GACCTTTCTTACTCTATCAATCGCA
>probe:Drosophila_2:1623109_at:599:275; Interrogation_Position=792; Antisense; CTTACTCTATCAATCGCACATCATT
>probe:Drosophila_2:1623109_at:550:49; Interrogation_Position=823; Antisense; ATGCCATCTTTTTGGTTCATTAGAA
>probe:Drosophila_2:1623109_at:623:645; Interrogation_Position=839; Antisense; TCATTAGAACGTTTGCGGCAGGCAT
>probe:Drosophila_2:1623109_at:38:349; Interrogation_Position=856; Antisense; GCAGGCATTGCCAAAGAATTGCAGT
>probe:Drosophila_2:1623109_at:396:429; Interrogation_Position=946; Antisense; GAGTTATACCATTTTCTCAGCTAAT

Paste this into a BLAST search page for me
AATGACGGTTTTAGTGCGTTAGACTTATGCGTCCCTCCAGAAATCGGAGAAAATCGGAGAACATGCGCACCAACTGAGAACATGCGCACCAACTACGATGCTACGATGCCGGCAACGAGTCGGATGGATGACTTCATGTAGTCCCCGGGTAAGTCCTGGTGCACCCTCGCATTTAGCATTTACCCAAAACATCCTTTGCCGACCTTTCTTACTCTATCAATCGCACTTACTCTATCAATCGCACATCATTATGCCATCTTTTTGGTTCATTAGAATCATTAGAACGTTTGCGGCAGGCATGCAGGCATTGCCAAAGAATTGCAGTGAGTTATACCATTTTCTCAGCTAAT

Full Affymetrix probeset data:

Annotations for 1623109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime