FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623111_at:

>probe:Drosophila_2:1623111_at:329:19; Interrogation_Position=125; Antisense; ATATTCGATTCCACCAGTTTTCAGG
>probe:Drosophila_2:1623111_at:260:303; Interrogation_Position=164; Antisense; CCCCAAGTCATCTGCACAAGTACAA
>probe:Drosophila_2:1623111_at:438:73; Interrogation_Position=198; Antisense; AGGACTACTGCAACTAAACCCCTTG
>probe:Drosophila_2:1623111_at:93:625; Interrogation_Position=224; Antisense; TGCCCACCATATTGAACTCCATGTT
>probe:Drosophila_2:1623111_at:681:245; Interrogation_Position=264; Antisense; AATTACCTTTGTGGATTTCGCTCTG
>probe:Drosophila_2:1623111_at:652:695; Interrogation_Position=301; Antisense; TTTCAGGCCCATTCTCTTAAAACCT
>probe:Drosophila_2:1623111_at:133:55; Interrogation_Position=416; Antisense; ATGACTTGGTTGTAGTTGTCCACAA
>probe:Drosophila_2:1623111_at:595:467; Interrogation_Position=430; Antisense; GTTGTCCACAAGCTGTTCTCAAATC
>probe:Drosophila_2:1623111_at:53:485; Interrogation_Position=45; Antisense; GTATCCCTCAGTTCCACAAGAGATT
>probe:Drosophila_2:1623111_at:639:543; Interrogation_Position=507; Antisense; GGATCATACGGACTCGAACCAAATA
>probe:Drosophila_2:1623111_at:703:355; Interrogation_Position=548; Antisense; GCAAAGCATTCGCAGTCTTCGACAT
>probe:Drosophila_2:1623111_at:221:229; Interrogation_Position=579; Antisense; AATGATGGTCACCTGGATACCCGAA
>probe:Drosophila_2:1623111_at:21:545; Interrogation_Position=593; Antisense; GGATACCCGAATACCATGGTCGAAC
>probe:Drosophila_2:1623111_at:110:429; Interrogation_Position=64; Antisense; GAGATTATGAACACCCTCAGGATGA

Paste this into a BLAST search page for me
ATATTCGATTCCACCAGTTTTCAGGCCCCAAGTCATCTGCACAAGTACAAAGGACTACTGCAACTAAACCCCTTGTGCCCACCATATTGAACTCCATGTTAATTACCTTTGTGGATTTCGCTCTGTTTCAGGCCCATTCTCTTAAAACCTATGACTTGGTTGTAGTTGTCCACAAGTTGTCCACAAGCTGTTCTCAAATCGTATCCCTCAGTTCCACAAGAGATTGGATCATACGGACTCGAACCAAATAGCAAAGCATTCGCAGTCTTCGACATAATGATGGTCACCTGGATACCCGAAGGATACCCGAATACCATGGTCGAACGAGATTATGAACACCCTCAGGATGA

Full Affymetrix probeset data:

Annotations for 1623111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720