Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623112_at:

>probe:Drosophila_2:1623112_at:164:407; Interrogation_Position=3822; Antisense; GACTGGTGGCCGGTACAAGCCAGAA
>probe:Drosophila_2:1623112_at:626:559; Interrogation_Position=3857; Antisense; GGAAATCTCCACCAAAAGGCAGTCG
>probe:Drosophila_2:1623112_at:516:3; Interrogation_Position=3882; Antisense; ATTGCTGAAGGAGGACCGAGCCCTA
>probe:Drosophila_2:1623112_at:362:105; Interrogation_Position=3959; Antisense; AGCACTCGGAGCACCGTTTCGAAAG
>probe:Drosophila_2:1623112_at:621:257; Interrogation_Position=4027; Antisense; CACTACATGTATCCTGAGACTCCGC
>probe:Drosophila_2:1623112_at:300:629; Interrogation_Position=4078; Antisense; TCCAAGTCCGGCAGAGAGTCCAAGA
>probe:Drosophila_2:1623112_at:592:533; Interrogation_Position=4155; Antisense; GGTGTCCAACTCAAAGATCTACGTG
>probe:Drosophila_2:1623112_at:653:587; Interrogation_Position=4178; Antisense; TGGAGCATCGCGGAACGGGTCATCC
>probe:Drosophila_2:1623112_at:445:531; Interrogation_Position=4194; Antisense; GGGTCATCCCACACAGAAGCAGCTA
>probe:Drosophila_2:1623112_at:204:377; Interrogation_Position=4209; Antisense; GAAGCAGCTAAACGCATCCACACTG
>probe:Drosophila_2:1623112_at:528:361; Interrogation_Position=4258; Antisense; GCAATGAACTCACTGCTCAACAGCT
>probe:Drosophila_2:1623112_at:302:339; Interrogation_Position=4272; Antisense; GCTCAACAGCTTGGGACGTCGCAAT
>probe:Drosophila_2:1623112_at:129:307; Interrogation_Position=4331; Antisense; CCTACGACGATGTCAGCCGGGTGAA
>probe:Drosophila_2:1623112_at:652:501; Interrogation_Position=4377; Antisense; GTCGCCGCAGTACTCGTAGAACGAT

Paste this into a BLAST search page for me
GACTGGTGGCCGGTACAAGCCAGAAGGAAATCTCCACCAAAAGGCAGTCGATTGCTGAAGGAGGACCGAGCCCTAAGCACTCGGAGCACCGTTTCGAAAGCACTACATGTATCCTGAGACTCCGCTCCAAGTCCGGCAGAGAGTCCAAGAGGTGTCCAACTCAAAGATCTACGTGTGGAGCATCGCGGAACGGGTCATCCGGGTCATCCCACACAGAAGCAGCTAGAAGCAGCTAAACGCATCCACACTGGCAATGAACTCACTGCTCAACAGCTGCTCAACAGCTTGGGACGTCGCAATCCTACGACGATGTCAGCCGGGTGAAGTCGCCGCAGTACTCGTAGAACGAT

Full Affymetrix probeset data:

Annotations for 1623112_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime