FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623113_at:

>probe:Drosophila_2:1623113_at:163:47; Interrogation_Position=1014; Antisense; ATCCGCGAGCCAGCAGTGGTGATCT
>probe:Drosophila_2:1623113_at:531:605; Interrogation_Position=1033; Antisense; TGATCTGTACAGCACCAAGCGGATG
>probe:Drosophila_2:1623113_at:269:373; Interrogation_Position=1081; Antisense; GAAGTCCGCCAGTAATGTGACCGAA
>probe:Drosophila_2:1623113_at:612:393; Interrogation_Position=1103; Antisense; GAAAGGAAGTCCGATACTCCTCCGC
>probe:Drosophila_2:1623113_at:308:669; Interrogation_Position=1117; Antisense; TACTCCTCCGCGTAATAGCCAGGAA
>probe:Drosophila_2:1623113_at:504:27; Interrogation_Position=1131; Antisense; ATAGCCAGGAAACTCAGCGCAGATC
>probe:Drosophila_2:1623113_at:709:123; Interrogation_Position=1146; Antisense; AGCGCAGATCCAGCCAGATGTCGAA
>probe:Drosophila_2:1623113_at:595:441; Interrogation_Position=1172; Antisense; GATGTCGTAAATGAAGATCCACCCG
>probe:Drosophila_2:1623113_at:148:375; Interrogation_Position=1184; Antisense; GAAGATCCACCCGAAGAAAGTTAGT
>probe:Drosophila_2:1623113_at:684:391; Interrogation_Position=1199; Antisense; GAAAGTTAGTTAATCGGACTCACAA
>probe:Drosophila_2:1623113_at:460:553; Interrogation_Position=769; Antisense; GGAGCTGGAGACCTACATAAAGCGA
>probe:Drosophila_2:1623113_at:393:189; Interrogation_Position=794; Antisense; AACATAAATCAGACGCGTCCTCCAG
>probe:Drosophila_2:1623113_at:723:597; Interrogation_Position=891; Antisense; TGTCCCTAAAGCAGCGCCGCGAGCA
>probe:Drosophila_2:1623113_at:195:555; Interrogation_Position=980; Antisense; GGAGCCTCGTTGAGTTTCGCTGGTC

Paste this into a BLAST search page for me
ATCCGCGAGCCAGCAGTGGTGATCTTGATCTGTACAGCACCAAGCGGATGGAAGTCCGCCAGTAATGTGACCGAAGAAAGGAAGTCCGATACTCCTCCGCTACTCCTCCGCGTAATAGCCAGGAAATAGCCAGGAAACTCAGCGCAGATCAGCGCAGATCCAGCCAGATGTCGAAGATGTCGTAAATGAAGATCCACCCGGAAGATCCACCCGAAGAAAGTTAGTGAAAGTTAGTTAATCGGACTCACAAGGAGCTGGAGACCTACATAAAGCGAAACATAAATCAGACGCGTCCTCCAGTGTCCCTAAAGCAGCGCCGCGAGCAGGAGCCTCGTTGAGTTTCGCTGGTC

Full Affymetrix probeset data:

Annotations for 1623113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720