Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623115_at:

>probe:Drosophila_2:1623115_at:465:417; Interrogation_Position=115; Antisense; GAGCGATCTGATTTGGATCACGAAT
>probe:Drosophila_2:1623115_at:459:453; Interrogation_Position=130; Antisense; GATCACGAATTGAGCCGATTGCGCA
>probe:Drosophila_2:1623115_at:152:465; Interrogation_Position=146; Antisense; GATTGCGCAAGCAGCAGGACGATAC
>probe:Drosophila_2:1623115_at:51:33; Interrogation_Position=176; Antisense; ATAATTTGGCAGAGGCGCTGGCCGA
>probe:Drosophila_2:1623115_at:592:577; Interrogation_Position=195; Antisense; GGCCGAGGACGAGTTCCAGTGCAAT
>probe:Drosophila_2:1623115_at:679:85; Interrogation_Position=212; Antisense; AGTGCAATTTGAGTGGCCAGCCATT
>probe:Drosophila_2:1623115_at:58:357; Interrogation_Position=25; Antisense; GCAAAGGGCTTTGGTCGTTTAATCA
>probe:Drosophila_2:1623115_at:579:239; Interrogation_Position=277; Antisense; AATCACCTCGGTAGCATTATCAACA
>probe:Drosophila_2:1623115_at:547:703; Interrogation_Position=293; Antisense; TTATCAACAAGCTGGCTGCCACGTA
>probe:Drosophila_2:1623115_at:433:671; Interrogation_Position=316; Antisense; TACGAGCGCCTTATTTACCTGGATG
>probe:Drosophila_2:1623115_at:533:429; Interrogation_Position=362; Antisense; GAGTCATTGAAAAGGCCATCACAGT
>probe:Drosophila_2:1623115_at:141:481; Interrogation_Position=38; Antisense; GTCGTTTAATCAATCCGGGCGTGGT
>probe:Drosophila_2:1623115_at:488:145; Interrogation_Position=63; Antisense; ACTCCATCCGGAACTGCATCAAAAG
>probe:Drosophila_2:1623115_at:135:727; Interrogation_Position=98; Antisense; TTGAGGCCATGACCATCGAGCGATC

Paste this into a BLAST search page for me
GAGCGATCTGATTTGGATCACGAATGATCACGAATTGAGCCGATTGCGCAGATTGCGCAAGCAGCAGGACGATACATAATTTGGCAGAGGCGCTGGCCGAGGCCGAGGACGAGTTCCAGTGCAATAGTGCAATTTGAGTGGCCAGCCATTGCAAAGGGCTTTGGTCGTTTAATCAAATCACCTCGGTAGCATTATCAACATTATCAACAAGCTGGCTGCCACGTATACGAGCGCCTTATTTACCTGGATGGAGTCATTGAAAAGGCCATCACAGTGTCGTTTAATCAATCCGGGCGTGGTACTCCATCCGGAACTGCATCAAAAGTTGAGGCCATGACCATCGAGCGATC

Full Affymetrix probeset data:

Annotations for 1623115_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime