Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623117_at:

>probe:Drosophila_2:1623117_at:382:9; Interrogation_Position=1762; Antisense; ATTCCATAAGGATACTCTGCCTCGC
>probe:Drosophila_2:1623117_at:15:217; Interrogation_Position=1821; Antisense; AAGTATACGCCTGTTGGCCGGGCAG
>probe:Drosophila_2:1623117_at:228:287; Interrogation_Position=1851; Antisense; CTGTGAGTGTGTGCGAATGGCCAAA
>probe:Drosophila_2:1623117_at:216:101; Interrogation_Position=1877; Antisense; AGAGTGTTGCCAACTGCATTGCCGG
>probe:Drosophila_2:1623117_at:111:549; Interrogation_Position=1953; Antisense; GGAGGCCAACGACGAGTCCTTTTTG
>probe:Drosophila_2:1623117_at:591:431; Interrogation_Position=1966; Antisense; GAGTCCTTTTTGGAGGCAGCGCATT
>probe:Drosophila_2:1623117_at:540:3; Interrogation_Position=1988; Antisense; ATTGGCTGCAGGACGACCGGCGACA
>probe:Drosophila_2:1623117_at:114:401; Interrogation_Position=2009; Antisense; GACAGGACGACCAATCACCAATCAA
>probe:Drosophila_2:1623117_at:575:33; Interrogation_Position=2029; Antisense; ATCAAATCGCGGCTTGTGCGCACTA
>probe:Drosophila_2:1623117_at:321:507; Interrogation_Position=2044; Antisense; GTGCGCACTATCACGGCCGTACGAA
>probe:Drosophila_2:1623117_at:119:169; Interrogation_Position=2074; Antisense; AAAGGCACGGCATCCAGGACCTCAG
>probe:Drosophila_2:1623117_at:449:289; Interrogation_Position=2100; Antisense; CGGAGACCCCAAGCCGATTGTCAAT
>probe:Drosophila_2:1623117_at:721:681; Interrogation_Position=2141; Antisense; TATGCCAACGTCTCCTATATTATAG
>probe:Drosophila_2:1623117_at:267:643; Interrogation_Position=2169; Antisense; TCTAGTCGTAAGTCACATGCCCAAG

Paste this into a BLAST search page for me
ATTCCATAAGGATACTCTGCCTCGCAAGTATACGCCTGTTGGCCGGGCAGCTGTGAGTGTGTGCGAATGGCCAAAAGAGTGTTGCCAACTGCATTGCCGGGGAGGCCAACGACGAGTCCTTTTTGGAGTCCTTTTTGGAGGCAGCGCATTATTGGCTGCAGGACGACCGGCGACAGACAGGACGACCAATCACCAATCAAATCAAATCGCGGCTTGTGCGCACTAGTGCGCACTATCACGGCCGTACGAAAAAGGCACGGCATCCAGGACCTCAGCGGAGACCCCAAGCCGATTGTCAATTATGCCAACGTCTCCTATATTATAGTCTAGTCGTAAGTCACATGCCCAAG

Full Affymetrix probeset data:

Annotations for 1623117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime