Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623118_s_at:

>probe:Drosophila_2:1623118_s_at:9:713; Interrogation_Position=101; Antisense; TTCAGCTCCAACTGCGGCACGTGAA
>probe:Drosophila_2:1623118_s_at:46:651; Interrogation_Position=102; Antisense; TCAGCTCCAACTGCGGCACGTGAAG
>probe:Drosophila_2:1623118_s_at:663:385; Interrogation_Position=141; Antisense; GAAAATTCACAAGGACCCGGTGGCA
>probe:Drosophila_2:1623118_s_at:12:247; Interrogation_Position=144; Antisense; AATTCACAAGGACCCGGTGGCAGAA
>probe:Drosophila_2:1623118_s_at:381:251; Interrogation_Position=150; Antisense; CAAGGACCCGGTGGCAGAAGAAGAA
>probe:Drosophila_2:1623118_s_at:61:561; Interrogation_Position=177; Antisense; GGCAGGACCGGAGGAGGAACCCCTG
>probe:Drosophila_2:1623118_s_at:246:607; Interrogation_Position=52; Antisense; TGCGGACCCCAGAGATTAGCCTCCA
>probe:Drosophila_2:1623118_s_at:234:555; Interrogation_Position=55; Antisense; GGACCCCAGAGATTAGCCTCCAATG
>probe:Drosophila_2:1623118_s_at:510:133; Interrogation_Position=57; Antisense; ACCCCAGAGATTAGCCTCCAATGGA
>probe:Drosophila_2:1623118_s_at:593:307; Interrogation_Position=60; Antisense; CCAGAGATTAGCCTCCAATGGAGGA
>probe:Drosophila_2:1623118_s_at:166:675; Interrogation_Position=68; Antisense; TAGCCTCCAATGGAGGAGCCGTGCT
>probe:Drosophila_2:1623118_s_at:305:629; Interrogation_Position=73; Antisense; TCCAATGGAGGAGCCGTGCTCCGGT
>probe:Drosophila_2:1623118_s_at:131:435; Interrogation_Position=80; Antisense; GAGGAGCCGTGCTCCGGTTGCTTCA
>probe:Drosophila_2:1623118_s_at:430:507; Interrogation_Position=88; Antisense; GTGCTCCGGTTGCTTCAGCTCCAAC

Paste this into a BLAST search page for me
TTCAGCTCCAACTGCGGCACGTGAATCAGCTCCAACTGCGGCACGTGAAGGAAAATTCACAAGGACCCGGTGGCAAATTCACAAGGACCCGGTGGCAGAACAAGGACCCGGTGGCAGAAGAAGAAGGCAGGACCGGAGGAGGAACCCCTGTGCGGACCCCAGAGATTAGCCTCCAGGACCCCAGAGATTAGCCTCCAATGACCCCAGAGATTAGCCTCCAATGGACCAGAGATTAGCCTCCAATGGAGGATAGCCTCCAATGGAGGAGCCGTGCTTCCAATGGAGGAGCCGTGCTCCGGTGAGGAGCCGTGCTCCGGTTGCTTCAGTGCTCCGGTTGCTTCAGCTCCAAC

Full Affymetrix probeset data:

Annotations for 1623118_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime