FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623119_at:

>probe:Drosophila_2:1623119_at:595:381; Interrogation_Position=1035; Antisense; GAACAGGAAGTCGAACTCCCGCCGT
>probe:Drosophila_2:1623119_at:577:339; Interrogation_Position=1070; Antisense; GCTAAGTTGTTGTCCAGTCGGTTAT
>probe:Drosophila_2:1623119_at:645:249; Interrogation_Position=1105; Antisense; CAAGGTTTTATTTTGAGCTCGTTCT
>probe:Drosophila_2:1623119_at:582:111; Interrogation_Position=724; Antisense; AGCAATCCTACTACCAACATGAAGT
>probe:Drosophila_2:1623119_at:286:495; Interrogation_Position=747; Antisense; GTCAACTATTCAAATCGGCACCCTG
>probe:Drosophila_2:1623119_at:596:133; Interrogation_Position=766; Antisense; ACCCTGTGCATCGTGGTGCTCGTGA
>probe:Drosophila_2:1623119_at:36:593; Interrogation_Position=779; Antisense; TGGTGCTCGTGATCTGCTGCCTGGA
>probe:Drosophila_2:1623119_at:191:585; Interrogation_Position=800; Antisense; TGGACTTCTCCAGTTCACAGAACTC
>probe:Drosophila_2:1623119_at:317:135; Interrogation_Position=865; Antisense; ACGCCCAAGAAAGTGTACCTGTCCA
>probe:Drosophila_2:1623119_at:604:285; Interrogation_Position=883; Antisense; CTGTCCAACTTGACGTACTCGATTG
>probe:Drosophila_2:1623119_at:472:73; Interrogation_Position=910; Antisense; AGGAAGATCCGTGTGGGCACCACCA
>probe:Drosophila_2:1623119_at:126:121; Interrogation_Position=949; Antisense; AGCCGTAGTTCCAGGACCAGGAGCA
>probe:Drosophila_2:1623119_at:247:551; Interrogation_Position=968; Antisense; GGAGCAACCGGAAACTGAACGCCAA
>probe:Drosophila_2:1623119_at:666:369; Interrogation_Position=993; Antisense; GAAGACCCAGGCCAAACGGAGCCAG

Paste this into a BLAST search page for me
GAACAGGAAGTCGAACTCCCGCCGTGCTAAGTTGTTGTCCAGTCGGTTATCAAGGTTTTATTTTGAGCTCGTTCTAGCAATCCTACTACCAACATGAAGTGTCAACTATTCAAATCGGCACCCTGACCCTGTGCATCGTGGTGCTCGTGATGGTGCTCGTGATCTGCTGCCTGGATGGACTTCTCCAGTTCACAGAACTCACGCCCAAGAAAGTGTACCTGTCCACTGTCCAACTTGACGTACTCGATTGAGGAAGATCCGTGTGGGCACCACCAAGCCGTAGTTCCAGGACCAGGAGCAGGAGCAACCGGAAACTGAACGCCAAGAAGACCCAGGCCAAACGGAGCCAG

Full Affymetrix probeset data:

Annotations for 1623119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720