FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623121_at:

>probe:Drosophila_2:1623121_at:327:619; Interrogation_Position=5356; Antisense; TGCTTGGCCACTCTTATTCGGGCAA
>probe:Drosophila_2:1623121_at:286:235; Interrogation_Position=5389; Antisense; AATGCCAGTCGAACGAAGCGCGCTG
>probe:Drosophila_2:1623121_at:95:627; Interrogation_Position=5417; Antisense; TGCCGCTCTACCAACAATTCTATGA
>probe:Drosophila_2:1623121_at:377:9; Interrogation_Position=5433; Antisense; ATTCTATGAGGAGCGCAACCGGTCG
>probe:Drosophila_2:1623121_at:663:253; Interrogation_Position=5448; Antisense; CAACCGGTCGTTGGATAGCGTATCA
>probe:Drosophila_2:1623121_at:358:455; Interrogation_Position=5461; Antisense; GATAGCGTATCATCTCGGTACAAGG
>probe:Drosophila_2:1623121_at:416:551; Interrogation_Position=5484; Antisense; GGAGAGCACCACTTTCGAAGACTTT
>probe:Drosophila_2:1623121_at:378:643; Interrogation_Position=5539; Antisense; TCTACGCTGGGCACACTAAGGGAAT
>probe:Drosophila_2:1623121_at:334:571; Interrogation_Position=5592; Antisense; GGCTTCTGCATTGCTGGATCACAAT
>probe:Drosophila_2:1623121_at:162:199; Interrogation_Position=5614; Antisense; AATCGTGCCTCCGTCAAAGGTTGGG
>probe:Drosophila_2:1623121_at:515:539; Interrogation_Position=5632; Antisense; GGTTGGGTACAAGCCTCGATTGATT
>probe:Drosophila_2:1623121_at:544:65; Interrogation_Position=5710; Antisense; ATGGAGGCAGCCACCGGAATGTCCT
>probe:Drosophila_2:1623121_at:370:719; Interrogation_Position=5796; Antisense; TTCGCTGCAGCATATCGCCGTGGGA
>probe:Drosophila_2:1623121_at:177:9; Interrogation_Position=5865; Antisense; ATTGCCGCAGCGACGCTTCAAATAA

Paste this into a BLAST search page for me
TGCTTGGCCACTCTTATTCGGGCAAAATGCCAGTCGAACGAAGCGCGCTGTGCCGCTCTACCAACAATTCTATGAATTCTATGAGGAGCGCAACCGGTCGCAACCGGTCGTTGGATAGCGTATCAGATAGCGTATCATCTCGGTACAAGGGGAGAGCACCACTTTCGAAGACTTTTCTACGCTGGGCACACTAAGGGAATGGCTTCTGCATTGCTGGATCACAATAATCGTGCCTCCGTCAAAGGTTGGGGGTTGGGTACAAGCCTCGATTGATTATGGAGGCAGCCACCGGAATGTCCTTTCGCTGCAGCATATCGCCGTGGGAATTGCCGCAGCGACGCTTCAAATAA

Full Affymetrix probeset data:

Annotations for 1623121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720