FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623122_at:

>probe:Drosophila_2:1623122_at:273:593; Interrogation_Position=420; Antisense; TGAGGCTTTTAACGTTCTATTGGAA
>probe:Drosophila_2:1623122_at:558:363; Interrogation_Position=450; Antisense; GAATCACAAACTGATCGCCGTGCAT
>probe:Drosophila_2:1623122_at:304:37; Interrogation_Position=463; Antisense; ATCGCCGTGCATCAGGGTAAGTACT
>probe:Drosophila_2:1623122_at:143:159; Interrogation_Position=488; Antisense; ACAAACGAGCAGAAGGCCTAGCCTT
>probe:Drosophila_2:1623122_at:68:319; Interrogation_Position=515; Antisense; GCCCAGGGTGCTTTGTCAAGGGTTT
>probe:Drosophila_2:1623122_at:537:205; Interrogation_Position=577; Antisense; AAGCCCAATCCTTATTTCTTCGAAG
>probe:Drosophila_2:1623122_at:549:17; Interrogation_Position=590; Antisense; ATTTCTTCGAAGGAGCTCTGGCTGG
>probe:Drosophila_2:1623122_at:138:449; Interrogation_Position=619; Antisense; GATCCAGCCTCATGCGTTATGATTG
>probe:Drosophila_2:1623122_at:466:231; Interrogation_Position=655; Antisense; AATGATGACATAGTGGGCGCCATGA
>probe:Drosophila_2:1623122_at:420:349; Interrogation_Position=690; Antisense; GCAGGGAATTCTGGTCAAGACCGGC
>probe:Drosophila_2:1623122_at:576:161; Interrogation_Position=715; Antisense; AAATATCTGCCGGATGTCAAACCAT
>probe:Drosophila_2:1623122_at:159:351; Interrogation_Position=772; Antisense; GCAGAGGCTGTCGATTGGATTATAC
>probe:Drosophila_2:1623122_at:365:237; Interrogation_Position=806; Antisense; AATCTTAGGCTTTATTGGGCTTCTG
>probe:Drosophila_2:1623122_at:226:525; Interrogation_Position=822; Antisense; GGGCTTCTGCAAATGTTTATCGTGT

Paste this into a BLAST search page for me
TGAGGCTTTTAACGTTCTATTGGAAGAATCACAAACTGATCGCCGTGCATATCGCCGTGCATCAGGGTAAGTACTACAAACGAGCAGAAGGCCTAGCCTTGCCCAGGGTGCTTTGTCAAGGGTTTAAGCCCAATCCTTATTTCTTCGAAGATTTCTTCGAAGGAGCTCTGGCTGGGATCCAGCCTCATGCGTTATGATTGAATGATGACATAGTGGGCGCCATGAGCAGGGAATTCTGGTCAAGACCGGCAAATATCTGCCGGATGTCAAACCATGCAGAGGCTGTCGATTGGATTATACAATCTTAGGCTTTATTGGGCTTCTGGGGCTTCTGCAAATGTTTATCGTGT

Full Affymetrix probeset data:

Annotations for 1623122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720