FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623124_at:

>probe:Drosophila_2:1623124_at:672:481; Interrogation_Position=3441; Antisense; GTATTCTCTCAATGGCAGGCGATTC
>probe:Drosophila_2:1623124_at:45:397; Interrogation_Position=3471; Antisense; GAAATTGCCAGAGCGCTCAGTCTCA
>probe:Drosophila_2:1623124_at:342:195; Interrogation_Position=3495; Antisense; AACGGCATTCAATTCCGCAATAAGT
>probe:Drosophila_2:1623124_at:525:365; Interrogation_Position=3548; Antisense; GAATCCGTTGAGCAATGTTACCTGT
>probe:Drosophila_2:1623124_at:6:61; Interrogation_Position=3562; Antisense; ATGTTACCTGTCTACTAATGCCACT
>probe:Drosophila_2:1623124_at:206:657; Interrogation_Position=3577; Antisense; TAATGCCACTGTCCAAAGGCTCAAA
>probe:Drosophila_2:1623124_at:266:481; Interrogation_Position=3604; Antisense; GTTTGAACCTGATCGAAGCCACACA
>probe:Drosophila_2:1623124_at:104:205; Interrogation_Position=3619; Antisense; AAGCCACACATGTTTTCCTCGTCGA
>probe:Drosophila_2:1623124_at:274:381; Interrogation_Position=3642; Antisense; GAACCCATTCTAAATCCGGGAGACG
>probe:Drosophila_2:1623124_at:488:413; Interrogation_Position=3666; Antisense; GAGCGCCAGGCCATAGGTCGTATTC
>probe:Drosophila_2:1623124_at:96:79; Interrogation_Position=3680; Antisense; AGGTCGTATTCACCGATTTGGGCAA
>probe:Drosophila_2:1623124_at:585:101; Interrogation_Position=3706; Antisense; AGAGACCCACGAAGGTGCATCGTTT
>probe:Drosophila_2:1623124_at:685:705; Interrogation_Position=3772; Antisense; TTACTTCAGCCGATGACACGACTAC
>probe:Drosophila_2:1623124_at:584:551; Interrogation_Position=3818; Antisense; GGAGAACATGACACTAGACAGCCTT

Paste this into a BLAST search page for me
GTATTCTCTCAATGGCAGGCGATTCGAAATTGCCAGAGCGCTCAGTCTCAAACGGCATTCAATTCCGCAATAAGTGAATCCGTTGAGCAATGTTACCTGTATGTTACCTGTCTACTAATGCCACTTAATGCCACTGTCCAAAGGCTCAAAGTTTGAACCTGATCGAAGCCACACAAAGCCACACATGTTTTCCTCGTCGAGAACCCATTCTAAATCCGGGAGACGGAGCGCCAGGCCATAGGTCGTATTCAGGTCGTATTCACCGATTTGGGCAAAGAGACCCACGAAGGTGCATCGTTTTTACTTCAGCCGATGACACGACTACGGAGAACATGACACTAGACAGCCTT

Full Affymetrix probeset data:

Annotations for 1623124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720