Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623125_at:

>probe:Drosophila_2:1623125_at:185:27; Interrogation_Position=1315; Antisense; ATAGCTGGTCTCAGCACCTATCTGA
>probe:Drosophila_2:1623125_at:536:685; Interrogation_Position=1333; Antisense; TATCTGATCTGGTTGCTGCCCGAAA
>probe:Drosophila_2:1623125_at:658:193; Interrogation_Position=1356; Antisense; AACTGAACGGAATTCACGCCGCGTG
>probe:Drosophila_2:1623125_at:347:13; Interrogation_Position=1407; Antisense; ATTAAAGATAGCCAACTCCGCCTCG
>probe:Drosophila_2:1623125_at:22:639; Interrogation_Position=1429; Antisense; TCGATTGCAGTGCTAACCACCTGTA
>probe:Drosophila_2:1623125_at:540:125; Interrogation_Position=1447; Antisense; ACCTGTACCAGTGAGATTGTGTCCA
>probe:Drosophila_2:1623125_at:133:107; Interrogation_Position=1475; Antisense; AGAAGCGGGTGGTCCTTATGCTTTC
>probe:Drosophila_2:1623125_at:116:53; Interrogation_Position=1492; Antisense; ATGCTTTCCGTGATCTCATTTAGCC
>probe:Drosophila_2:1623125_at:636:699; Interrogation_Position=1539; Antisense; TTTTCTAAGCTGTCTCACTGTCATC
>probe:Drosophila_2:1623125_at:435:309; Interrogation_Position=1592; Antisense; CCACCATGGGCTGGATTTACGGCTT
>probe:Drosophila_2:1623125_at:12:553; Interrogation_Position=1653; Antisense; GGAGCAGCCCCAAATCAGTCAGGTG
>probe:Drosophila_2:1623125_at:647:595; Interrogation_Position=1734; Antisense; TGTGAGTTCCGATTGCAGTGCCTAC
>probe:Drosophila_2:1623125_at:549:419; Interrogation_Position=1765; Antisense; GAGCTTCTCAGCAACTTTGAGCGAA
>probe:Drosophila_2:1623125_at:298:83; Interrogation_Position=1867; Antisense; AGTGGTCCGGAAGCTCACAGAGCAC

Paste this into a BLAST search page for me
ATAGCTGGTCTCAGCACCTATCTGATATCTGATCTGGTTGCTGCCCGAAAAACTGAACGGAATTCACGCCGCGTGATTAAAGATAGCCAACTCCGCCTCGTCGATTGCAGTGCTAACCACCTGTAACCTGTACCAGTGAGATTGTGTCCAAGAAGCGGGTGGTCCTTATGCTTTCATGCTTTCCGTGATCTCATTTAGCCTTTTCTAAGCTGTCTCACTGTCATCCCACCATGGGCTGGATTTACGGCTTGGAGCAGCCCCAAATCAGTCAGGTGTGTGAGTTCCGATTGCAGTGCCTACGAGCTTCTCAGCAACTTTGAGCGAAAGTGGTCCGGAAGCTCACAGAGCAC

Full Affymetrix probeset data:

Annotations for 1623125_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime