FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623126_at:

>probe:Drosophila_2:1623126_at:218:671; Interrogation_Position=190; Antisense; TACGGCACTACGGATACAGGCATTT
>probe:Drosophila_2:1623126_at:344:651; Interrogation_Position=234; Antisense; TCACATACTGTGAGGGTCTTCAAGA
>probe:Drosophila_2:1623126_at:287:443; Interrogation_Position=260; Antisense; GATGTACATTGTGGCGGGCATCCTC
>probe:Drosophila_2:1623126_at:308:361; Interrogation_Position=289; Antisense; GCAATGCGGAGATCTGCGACACAGT
>probe:Drosophila_2:1623126_at:31:85; Interrogation_Position=311; Antisense; AGTGGACCGCATCCAGATAGCGCCA
>probe:Drosophila_2:1623126_at:322:413; Interrogation_Position=342; Antisense; GACCTCAAGCCGGAATACGATCACA
>probe:Drosophila_2:1623126_at:124:455; Interrogation_Position=360; Antisense; GATCACAGGTACTTGACCTCCGGAG
>probe:Drosophila_2:1623126_at:327:547; Interrogation_Position=381; Antisense; GGAGGCAATAGTCCCGGCTCCCGAT
>probe:Drosophila_2:1623126_at:152:307; Interrogation_Position=413; Antisense; CCACTCTCGACAGAATTCCGGAAGT
>probe:Drosophila_2:1623126_at:612:495; Interrogation_Position=531; Antisense; GTCACCAAGAGAGTGGGCCACCGCT
>probe:Drosophila_2:1623126_at:536:11; Interrogation_Position=582; Antisense; ATTCTCCGGCAATGGCGACTCCTGG
>probe:Drosophila_2:1623126_at:614:9; Interrogation_Position=630; Antisense; ATTCCCAACTTCTTGGTGCAGTGCC
>probe:Drosophila_2:1623126_at:54:507; Interrogation_Position=650; Antisense; GTGCCTCACCAGCTACATGAGCAAG
>probe:Drosophila_2:1623126_at:645:119; Interrogation_Position=676; Antisense; AGCTGCTCATCAATAGCGACTGTGA

Paste this into a BLAST search page for me
TACGGCACTACGGATACAGGCATTTTCACATACTGTGAGGGTCTTCAAGAGATGTACATTGTGGCGGGCATCCTCGCAATGCGGAGATCTGCGACACAGTAGTGGACCGCATCCAGATAGCGCCAGACCTCAAGCCGGAATACGATCACAGATCACAGGTACTTGACCTCCGGAGGGAGGCAATAGTCCCGGCTCCCGATCCACTCTCGACAGAATTCCGGAAGTGTCACCAAGAGAGTGGGCCACCGCTATTCTCCGGCAATGGCGACTCCTGGATTCCCAACTTCTTGGTGCAGTGCCGTGCCTCACCAGCTACATGAGCAAGAGCTGCTCATCAATAGCGACTGTGA

Full Affymetrix probeset data:

Annotations for 1623126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720