FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623128_at:

>probe:Drosophila_2:1623128_at:477:373; Interrogation_Position=1034; Antisense; GAAGTCGCCCATTTCTCCGGAGAAT
>probe:Drosophila_2:1623128_at:169:85; Interrogation_Position=1084; Antisense; AGTGCTTTATGGATGCGCTCAGGAA
>probe:Drosophila_2:1623128_at:580:73; Interrogation_Position=1104; Antisense; AGGAACTGCTGCTGCCTGCGAAAAG
>probe:Drosophila_2:1623128_at:481:387; Interrogation_Position=1123; Antisense; GAAAAGTCCACGAGCTTCAGCAGCA
>probe:Drosophila_2:1623128_at:34:89; Interrogation_Position=1193; Antisense; AGTCGATGACTTGCTCACACCGAAG
>probe:Drosophila_2:1623128_at:382:371; Interrogation_Position=1214; Antisense; GAAGGCCAGGGAACGCTCAAGTCAA
>probe:Drosophila_2:1623128_at:539:401; Interrogation_Position=1279; Antisense; GACATCCTCGTATTCGACGTTACAG
>probe:Drosophila_2:1623128_at:61:139; Interrogation_Position=1295; Antisense; ACGTTACAGGCATTCAGCTCGTTAA
>probe:Drosophila_2:1623128_at:588:115; Interrogation_Position=1310; Antisense; AGCTCGTTAAATCTTCACTTTTGGT
>probe:Drosophila_2:1623128_at:543:89; Interrogation_Position=871; Antisense; AGTACCGGAGTGAACAGCGCCGTTT
>probe:Drosophila_2:1623128_at:392:123; Interrogation_Position=886; Antisense; AGCGCCGTTTCGAGATGCTGTGCAC
>probe:Drosophila_2:1623128_at:439:333; Interrogation_Position=902; Antisense; GCTGTGCACTCGCTATATTCAAATG
>probe:Drosophila_2:1623128_at:700:171; Interrogation_Position=959; Antisense; AAAGAATACACTCGGTCAGGCTAGC
>probe:Drosophila_2:1623128_at:381:123; Interrogation_Position=981; Antisense; AGCGAGTGTATATTCCATGCCCAGG

Paste this into a BLAST search page for me
GAAGTCGCCCATTTCTCCGGAGAATAGTGCTTTATGGATGCGCTCAGGAAAGGAACTGCTGCTGCCTGCGAAAAGGAAAAGTCCACGAGCTTCAGCAGCAAGTCGATGACTTGCTCACACCGAAGGAAGGCCAGGGAACGCTCAAGTCAAGACATCCTCGTATTCGACGTTACAGACGTTACAGGCATTCAGCTCGTTAAAGCTCGTTAAATCTTCACTTTTGGTAGTACCGGAGTGAACAGCGCCGTTTAGCGCCGTTTCGAGATGCTGTGCACGCTGTGCACTCGCTATATTCAAATGAAAGAATACACTCGGTCAGGCTAGCAGCGAGTGTATATTCCATGCCCAGG

Full Affymetrix probeset data:

Annotations for 1623128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720