FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623130_at:

>probe:Drosophila_2:1623130_at:561:61; Interrogation_Position=102; Antisense; ATGTGTCCCACCTGTCGGGCTACAA
>probe:Drosophila_2:1623130_at:271:127; Interrogation_Position=111; Antisense; ACCTGTCGGGCTACAACTATGCTCC
>probe:Drosophila_2:1623130_at:78:339; Interrogation_Position=120; Antisense; GCTACAACTATGCTCCCGTCAGCAT
>probe:Drosophila_2:1623130_at:458:287; Interrogation_Position=23; Antisense; CGTCCACGTTCCAAGTAACATACAT
>probe:Drosophila_2:1623130_at:74:129; Interrogation_Position=235; Antisense; ACCAGCTCCCGTCCAGATTGAAGTT
>probe:Drosophila_2:1623130_at:367:505; Interrogation_Position=245; Antisense; GTCCAGATTGAAGTTCCCGCTCCAG
>probe:Drosophila_2:1623130_at:678:469; Interrogation_Position=30; Antisense; GTTCCAAGTAACATACATCCACAAT
>probe:Drosophila_2:1623130_at:465:351; Interrogation_Position=347; Antisense; GCACCCGTTCAGGTTGAGATTCCCG
>probe:Drosophila_2:1623130_at:186:471; Interrogation_Position=353; Antisense; GTTCAGGTTGAGATTCCCGCCCCAG
>probe:Drosophila_2:1623130_at:510:29; Interrogation_Position=42; Antisense; ATACATCCACAATGAAATTCCTGGT
>probe:Drosophila_2:1623130_at:615:629; Interrogation_Position=532; Antisense; TCCTCAGCCCGTTCTGGAGGAGATC
>probe:Drosophila_2:1623130_at:390:395; Interrogation_Position=55; Antisense; GAAATTCCTGGTTGTCGCCGTCGCC
>probe:Drosophila_2:1623130_at:608:425; Interrogation_Position=551; Antisense; GAGATCGAGCCCGTGTCCGCCGATG
>probe:Drosophila_2:1623130_at:643:727; Interrogation_Position=83; Antisense; TTGGCCGTTGCCCACGCCGATGTGT

Paste this into a BLAST search page for me
ATGTGTCCCACCTGTCGGGCTACAAACCTGTCGGGCTACAACTATGCTCCGCTACAACTATGCTCCCGTCAGCATCGTCCACGTTCCAAGTAACATACATACCAGCTCCCGTCCAGATTGAAGTTGTCCAGATTGAAGTTCCCGCTCCAGGTTCCAAGTAACATACATCCACAATGCACCCGTTCAGGTTGAGATTCCCGGTTCAGGTTGAGATTCCCGCCCCAGATACATCCACAATGAAATTCCTGGTTCCTCAGCCCGTTCTGGAGGAGATCGAAATTCCTGGTTGTCGCCGTCGCCGAGATCGAGCCCGTGTCCGCCGATGTTGGCCGTTGCCCACGCCGATGTGT

Full Affymetrix probeset data:

Annotations for 1623130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720