FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623134_at:

>probe:Drosophila_2:1623134_at:204:193; Interrogation_Position=17; Antisense; AACTGCCAGAGAGAAAATGCGTTCC
>probe:Drosophila_2:1623134_at:146:301; Interrogation_Position=190; Antisense; CCCAGGAAGGACAACAGGGAGGTCA
>probe:Drosophila_2:1623134_at:54:435; Interrogation_Position=208; Antisense; GAGGTCAGCAGGGAGGTCAGCAGCA
>probe:Drosophila_2:1623134_at:642:71; Interrogation_Position=310; Antisense; AGGCTACCAGCACTGAATCCAGCAG
>probe:Drosophila_2:1623134_at:361:233; Interrogation_Position=325; Antisense; AATCCAGCAGCACAGAGGTTTCCTC
>probe:Drosophila_2:1623134_at:591:433; Interrogation_Position=339; Antisense; GAGGTTTCCTCTTCGTAACTTATAG
>probe:Drosophila_2:1623134_at:671:537; Interrogation_Position=341; Antisense; GGTTTCCTCTTCGTAACTTATAGAT
>probe:Drosophila_2:1623134_at:509:273; Interrogation_Position=349; Antisense; CTTCGTAACTTATAGATTGATCCTA
>probe:Drosophila_2:1623134_at:413:465; Interrogation_Position=363; Antisense; GATTGATCCTAATGAAAGCGAACAG
>probe:Drosophila_2:1623134_at:137:207; Interrogation_Position=378; Antisense; AAGCGAACAGGCTTGCTCAGTTCCT
>probe:Drosophila_2:1623134_at:152:189; Interrogation_Position=383; Antisense; AACAGGCTTGCTCAGTTCCTTACCA
>probe:Drosophila_2:1623134_at:128:719; Interrogation_Position=398; Antisense; TTCCTTACCATTCCCTTTATCAATA
>probe:Drosophila_2:1623134_at:396:715; Interrogation_Position=408; Antisense; TTCCCTTTATCAATACAAGTTCTTG
>probe:Drosophila_2:1623134_at:653:393; Interrogation_Position=432; Antisense; GAAATAAATTGATATCAGTACTCTA

Paste this into a BLAST search page for me
AACTGCCAGAGAGAAAATGCGTTCCCCCAGGAAGGACAACAGGGAGGTCAGAGGTCAGCAGGGAGGTCAGCAGCAAGGCTACCAGCACTGAATCCAGCAGAATCCAGCAGCACAGAGGTTTCCTCGAGGTTTCCTCTTCGTAACTTATAGGGTTTCCTCTTCGTAACTTATAGATCTTCGTAACTTATAGATTGATCCTAGATTGATCCTAATGAAAGCGAACAGAAGCGAACAGGCTTGCTCAGTTCCTAACAGGCTTGCTCAGTTCCTTACCATTCCTTACCATTCCCTTTATCAATATTCCCTTTATCAATACAAGTTCTTGGAAATAAATTGATATCAGTACTCTA

Full Affymetrix probeset data:

Annotations for 1623134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720