Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623137_s_at:

>probe:Drosophila_2:1623137_s_at:523:477; Interrogation_Position=406; Antisense; GTTTCGGATCGTCTTGCCACACAAC
>probe:Drosophila_2:1623137_s_at:209:175; Interrogation_Position=446; Antisense; AAAGCGAATCCTCGACAACTGAATT
>probe:Drosophila_2:1623137_s_at:318:159; Interrogation_Position=460; Antisense; ACAACTGAATTCCATCCGACATCGA
>probe:Drosophila_2:1623137_s_at:10:401; Interrogation_Position=477; Antisense; GACATCGAAACTGTTTATCTCGGGA
>probe:Drosophila_2:1623137_s_at:448:37; Interrogation_Position=493; Antisense; ATCTCGGGAAATTCAAACGCTGCAG
>probe:Drosophila_2:1623137_s_at:503:327; Interrogation_Position=537; Antisense; GCGATCGCGATCATCAAATTGCAAT
>probe:Drosophila_2:1623137_s_at:447:161; Interrogation_Position=552; Antisense; AAATTGCAATTGTGGCTGGCCCGTC
>probe:Drosophila_2:1623137_s_at:552:525; Interrogation_Position=677; Antisense; GGGAAATTCAAAACGCGTCGCGTCG
>probe:Drosophila_2:1623137_s_at:168:321; Interrogation_Position=720; Antisense; GCCGCCAATTGCATCTGTTGTTTGT
>probe:Drosophila_2:1623137_s_at:622:433; Interrogation_Position=769; Antisense; GAGTGTGCCATCTATATTGCATTGT
>probe:Drosophila_2:1623137_s_at:598:7; Interrogation_Position=784; Antisense; ATTGCATTGTTGTTGTTTCTCTTTT
>probe:Drosophila_2:1623137_s_at:565:183; Interrogation_Position=885; Antisense; AAAAGTGAGACGACGGCTGGCGAAA
>probe:Drosophila_2:1623137_s_at:577:721; Interrogation_Position=927; Antisense; TTGCAGTTTGCAGTTGGCAGCAGCT
>probe:Drosophila_2:1623137_s_at:208:117; Interrogation_Position=969; Antisense; AGCTTAGCATACTTTTGGGCCTGCC

Paste this into a BLAST search page for me
GTTTCGGATCGTCTTGCCACACAACAAAGCGAATCCTCGACAACTGAATTACAACTGAATTCCATCCGACATCGAGACATCGAAACTGTTTATCTCGGGAATCTCGGGAAATTCAAACGCTGCAGGCGATCGCGATCATCAAATTGCAATAAATTGCAATTGTGGCTGGCCCGTCGGGAAATTCAAAACGCGTCGCGTCGGCCGCCAATTGCATCTGTTGTTTGTGAGTGTGCCATCTATATTGCATTGTATTGCATTGTTGTTGTTTCTCTTTTAAAAGTGAGACGACGGCTGGCGAAATTGCAGTTTGCAGTTGGCAGCAGCTAGCTTAGCATACTTTTGGGCCTGCC

Full Affymetrix probeset data:

Annotations for 1623137_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime