Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623138_at:

>probe:Drosophila_2:1623138_at:413:663; Interrogation_Position=4052; Antisense; TAAACCGACACTACCTTTATCCACA
>probe:Drosophila_2:1623138_at:502:699; Interrogation_Position=4067; Antisense; TTTATCCACACCATGCAACTCACAA
>probe:Drosophila_2:1623138_at:673:253; Interrogation_Position=4082; Antisense; CAACTCACAACTAAGCACCCAGAAT
>probe:Drosophila_2:1623138_at:305:111; Interrogation_Position=4095; Antisense; AGCACCCAGAATTCGGATTGTTCAG
>probe:Drosophila_2:1623138_at:687:541; Interrogation_Position=4109; Antisense; GGATTGTTCAGTTTCGCATTCAGTA
>probe:Drosophila_2:1623138_at:325:265; Interrogation_Position=4117; Antisense; CAGTTTCGCATTCAGTATGTACTAT
>probe:Drosophila_2:1623138_at:313:1; Interrogation_Position=4198; Antisense; AGTGTCGAAAAATCTGTTAACCGCA
>probe:Drosophila_2:1623138_at:109:705; Interrogation_Position=4214; Antisense; TTAACCGCAACTCTGTAAAAGTAAT
>probe:Drosophila_2:1623138_at:243:477; Interrogation_Position=4256; Antisense; GTTTTATCCTGTTCTTTTATAGTGT
>probe:Drosophila_2:1623138_at:396:427; Interrogation_Position=4295; Antisense; GATTTTACCATTATTCTTAGACTAT
>probe:Drosophila_2:1623138_at:125:225; Interrogation_Position=4337; Antisense; AAGGAAAGTATATCGCGCATAAGTT
>probe:Drosophila_2:1623138_at:235:53; Interrogation_Position=4380; Antisense; ATGAAAACGTAAACAGAGCCTTATT
>probe:Drosophila_2:1623138_at:508:183; Interrogation_Position=4413; Antisense; AAAATTAACTTTTCTATGATCGCAG
>probe:Drosophila_2:1623138_at:235:665; Interrogation_Position=4473; Antisense; TACAATTGTCTCGTTAAATTCAACA

Paste this into a BLAST search page for me
TAAACCGACACTACCTTTATCCACATTTATCCACACCATGCAACTCACAACAACTCACAACTAAGCACCCAGAATAGCACCCAGAATTCGGATTGTTCAGGGATTGTTCAGTTTCGCATTCAGTACAGTTTCGCATTCAGTATGTACTATAGTGTCGAAAAATCTGTTAACCGCATTAACCGCAACTCTGTAAAAGTAATGTTTTATCCTGTTCTTTTATAGTGTGATTTTACCATTATTCTTAGACTATAAGGAAAGTATATCGCGCATAAGTTATGAAAACGTAAACAGAGCCTTATTAAAATTAACTTTTCTATGATCGCAGTACAATTGTCTCGTTAAATTCAACA

Full Affymetrix probeset data:

Annotations for 1623138_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime