Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623139_at:

>probe:Drosophila_2:1623139_at:48:565; Interrogation_Position=2585; Antisense; GGCAATCTGTGATGCTCTGAGGGAT
>probe:Drosophila_2:1623139_at:543:617; Interrogation_Position=2632; Antisense; TGCAGCGTGAAATGGCCGAGACTAC
>probe:Drosophila_2:1623139_at:658:125; Interrogation_Position=2706; Antisense; AGCCTCACCGTTGAGTCTCAGGATA
>probe:Drosophila_2:1623139_at:628:443; Interrogation_Position=2747; Antisense; GATGATGCTGCTGGTTAAGCCCTTT
>probe:Drosophila_2:1623139_at:271:711; Interrogation_Position=2761; Antisense; TTAAGCCCTTTTTCATCTTCATCTG
>probe:Drosophila_2:1623139_at:358:161; Interrogation_Position=2791; Antisense; ACAAGTTCCACAGCGATTGCCTGGA
>probe:Drosophila_2:1623139_at:98:721; Interrogation_Position=2807; Antisense; TTGCCTGGAGAAGCACGTTGTGCCC
>probe:Drosophila_2:1623139_at:197:651; Interrogation_Position=2836; Antisense; TCACCAAGGAGCAATGTCGGCGCCT
>probe:Drosophila_2:1623139_at:331:281; Interrogation_Position=2859; Antisense; CTCGGCACTCTAAAGCAGCAACTGG
>probe:Drosophila_2:1623139_at:11:497; Interrogation_Position=2915; Antisense; GTCAGGTGCCCTGAGCAAACAGCAG
>probe:Drosophila_2:1623139_at:271:459; Interrogation_Position=2988; Antisense; GATATTCTTGCTGCGGATTGCCTAT
>probe:Drosophila_2:1623139_at:73:465; Interrogation_Position=3003; Antisense; GATTGCCTATTCTGCGGGCTGCTAA
>probe:Drosophila_2:1623139_at:250:123; Interrogation_Position=3043; Antisense; AGCCGTTCGTTGACGACTGGGAGCA
>probe:Drosophila_2:1623139_at:416:83; Interrogation_Position=3079; Antisense; AGTGGGAGTAGTTCGCTACCACCGT

Paste this into a BLAST search page for me
GGCAATCTGTGATGCTCTGAGGGATTGCAGCGTGAAATGGCCGAGACTACAGCCTCACCGTTGAGTCTCAGGATAGATGATGCTGCTGGTTAAGCCCTTTTTAAGCCCTTTTTCATCTTCATCTGACAAGTTCCACAGCGATTGCCTGGATTGCCTGGAGAAGCACGTTGTGCCCTCACCAAGGAGCAATGTCGGCGCCTCTCGGCACTCTAAAGCAGCAACTGGGTCAGGTGCCCTGAGCAAACAGCAGGATATTCTTGCTGCGGATTGCCTATGATTGCCTATTCTGCGGGCTGCTAAAGCCGTTCGTTGACGACTGGGAGCAAGTGGGAGTAGTTCGCTACCACCGT

Full Affymetrix probeset data:

Annotations for 1623139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime