Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623144_at:

>probe:Drosophila_2:1623144_at:370:481; Interrogation_Position=5078; Antisense; GTTTGTGACACCCAAGCGAGTAATA
>probe:Drosophila_2:1623144_at:354:327; Interrogation_Position=5093; Antisense; GCGAGTAATACTTCGGTTATGCATT
>probe:Drosophila_2:1623144_at:375:667; Interrogation_Position=5122; Antisense; TACATATCAGCGTACTCTGGAATAT
>probe:Drosophila_2:1623144_at:645:549; Interrogation_Position=5170; Antisense; GGAGACGAACAACACATCTACCAAT
>probe:Drosophila_2:1623144_at:55:29; Interrogation_Position=5193; Antisense; ATCAAATACAAAGCCTCCCGGGAAT
>probe:Drosophila_2:1623144_at:133:297; Interrogation_Position=5210; Antisense; CCGGGAATGCCGGTAAACAATACAT
>probe:Drosophila_2:1623144_at:506:185; Interrogation_Position=5225; Antisense; AACAATACATTGTTTCCCGATGTTA
>probe:Drosophila_2:1623144_at:662:717; Interrogation_Position=5238; Antisense; TTCCCGATGTTAGCAGCTCTACACA
>probe:Drosophila_2:1623144_at:146:263; Interrogation_Position=5251; Antisense; CAGCTCTACACATCCATATCATGGG
>probe:Drosophila_2:1623144_at:98:139; Interrogation_Position=5292; Antisense; ACGATATGACTACATCCCTTACTTC
>probe:Drosophila_2:1623144_at:680:257; Interrogation_Position=5304; Antisense; CATCCCTTACTTCCTTACTCGAGGA
>probe:Drosophila_2:1623144_at:507:185; Interrogation_Position=5577; Antisense; AACAATATAATGTCTTCCGAGCTAT
>probe:Drosophila_2:1623144_at:728:479; Interrogation_Position=5588; Antisense; GTCTTCCGAGCTATTTTAAACATTA
>probe:Drosophila_2:1623144_at:715:357; Interrogation_Position=5617; Antisense; GCAATGATTATGCTCTTACTAAATA

Paste this into a BLAST search page for me
GTTTGTGACACCCAAGCGAGTAATAGCGAGTAATACTTCGGTTATGCATTTACATATCAGCGTACTCTGGAATATGGAGACGAACAACACATCTACCAATATCAAATACAAAGCCTCCCGGGAATCCGGGAATGCCGGTAAACAATACATAACAATACATTGTTTCCCGATGTTATTCCCGATGTTAGCAGCTCTACACACAGCTCTACACATCCATATCATGGGACGATATGACTACATCCCTTACTTCCATCCCTTACTTCCTTACTCGAGGAAACAATATAATGTCTTCCGAGCTATGTCTTCCGAGCTATTTTAAACATTAGCAATGATTATGCTCTTACTAAATA

Full Affymetrix probeset data:

Annotations for 1623144_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime