FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623146_at:

>probe:Drosophila_2:1623146_at:273:269; Interrogation_Position=106; Antisense; CATGTGGTCGTCATTAACAGCGTCA
>probe:Drosophila_2:1623146_at:692:185; Interrogation_Position=121; Antisense; AACAGCGTCAGCATAAGTCCCGGAG
>probe:Drosophila_2:1623146_at:68:43; Interrogation_Position=13; Antisense; ATGCGAGCCGTTCTGGACACCAATT
>probe:Drosophila_2:1623146_at:206:553; Interrogation_Position=142; Antisense; GGAGCCGTCGACACAGAGATCATTG
>probe:Drosophila_2:1623146_at:391:657; Interrogation_Position=180; Antisense; TAAGGTCATTCCAAACTTTCCCATG
>probe:Drosophila_2:1623146_at:168:149; Interrogation_Position=194; Antisense; ACTTTCCCATGCTGCGCGCTGAGGA
>probe:Drosophila_2:1623146_at:530:547; Interrogation_Position=216; Antisense; GGATGTCGCCGACGCAGTGTCCTAT
>probe:Drosophila_2:1623146_at:293:85; Interrogation_Position=231; Antisense; AGTGTCCTATTACATCCAGACGCCT
>probe:Drosophila_2:1623146_at:332:317; Interrogation_Position=252; Antisense; GCCTCCCAATGTGCAGATCCATGAG
>probe:Drosophila_2:1623146_at:36:559; Interrogation_Position=27; Antisense; GGACACCAATTTACTGGGATTCGTG
>probe:Drosophila_2:1623146_at:93:57; Interrogation_Position=272; Antisense; ATGAGCTCACAATCAAGCCCGTCGG
>probe:Drosophila_2:1623146_at:362:11; Interrogation_Position=45; Antisense; ATTCGTGTGGTGTGCCCGCGAAGCC
>probe:Drosophila_2:1623146_at:391:379; Interrogation_Position=64; Antisense; GAAGCCTTCCGATCGCAGCAGACGC
>probe:Drosophila_2:1623146_at:641:197; Interrogation_Position=91; Antisense; AACGTCACCGATGGCCATGTGGTCG

Paste this into a BLAST search page for me
CATGTGGTCGTCATTAACAGCGTCAAACAGCGTCAGCATAAGTCCCGGAGATGCGAGCCGTTCTGGACACCAATTGGAGCCGTCGACACAGAGATCATTGTAAGGTCATTCCAAACTTTCCCATGACTTTCCCATGCTGCGCGCTGAGGAGGATGTCGCCGACGCAGTGTCCTATAGTGTCCTATTACATCCAGACGCCTGCCTCCCAATGTGCAGATCCATGAGGGACACCAATTTACTGGGATTCGTGATGAGCTCACAATCAAGCCCGTCGGATTCGTGTGGTGTGCCCGCGAAGCCGAAGCCTTCCGATCGCAGCAGACGCAACGTCACCGATGGCCATGTGGTCG

Full Affymetrix probeset data:

Annotations for 1623146_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720