FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623147_at:

>probe:Drosophila_2:1623147_at:168:223; Interrogation_Position=140; Antisense; AAGGGTCTGCCCATACACGATTCGA
>probe:Drosophila_2:1623147_at:279:635; Interrogation_Position=161; Antisense; TCGAGCAATTTTACCCATTTGAGCA
>probe:Drosophila_2:1623147_at:678:9; Interrogation_Position=197; Antisense; ATTCGAACGTCGCAGAAGCGTGCCT
>probe:Drosophila_2:1623147_at:413:625; Interrogation_Position=231; Antisense; TGCCCACCGAGGATGAGCATTCAGA
>probe:Drosophila_2:1623147_at:368:253; Interrogation_Position=274; Antisense; CAAGCGATGTGTCCTGCTGCGCTAC
>probe:Drosophila_2:1623147_at:215:279; Interrogation_Position=295; Antisense; CTACCTCACTCAGCAGTGGGACAAA
>probe:Drosophila_2:1623147_at:97:729; Interrogation_Position=425; Antisense; TTGGACCCCAACGAGCTGAACTGAG
>probe:Drosophila_2:1623147_at:587:71; Interrogation_Position=459; Antisense; AGGACCTTAAGCCAAGCACCCGATG
>probe:Drosophila_2:1623147_at:455:351; Interrogation_Position=495; Antisense; GCAGCACTACTATCCCGAGCGAACA
>probe:Drosophila_2:1623147_at:300:313; Interrogation_Position=527; Antisense; GCCACCATTCATTTACACTCATATA
>probe:Drosophila_2:1623147_at:299:469; Interrogation_Position=588; Antisense; GTTGCAGTCGAACGGTCCTTTCAAA
>probe:Drosophila_2:1623147_at:437:651; Interrogation_Position=608; Antisense; TCAAAGTTTTGTATCACGCTGATCA
>probe:Drosophila_2:1623147_at:183:327; Interrogation_Position=625; Antisense; GCTGATCATTGGTCGAAAGCCCCAG
>probe:Drosophila_2:1623147_at:128:391; Interrogation_Position=639; Antisense; GAAAGCCCCAGTATTTCTTTAGATT

Paste this into a BLAST search page for me
AAGGGTCTGCCCATACACGATTCGATCGAGCAATTTTACCCATTTGAGCAATTCGAACGTCGCAGAAGCGTGCCTTGCCCACCGAGGATGAGCATTCAGACAAGCGATGTGTCCTGCTGCGCTACCTACCTCACTCAGCAGTGGGACAAATTGGACCCCAACGAGCTGAACTGAGAGGACCTTAAGCCAAGCACCCGATGGCAGCACTACTATCCCGAGCGAACAGCCACCATTCATTTACACTCATATAGTTGCAGTCGAACGGTCCTTTCAAATCAAAGTTTTGTATCACGCTGATCAGCTGATCATTGGTCGAAAGCCCCAGGAAAGCCCCAGTATTTCTTTAGATT

Full Affymetrix probeset data:

Annotations for 1623147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720