FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623148_at:

>probe:Drosophila_2:1623148_at:305:205; Interrogation_Position=1745; Antisense; AAGCCGGACAACAGCGACTCATATG
>probe:Drosophila_2:1623148_at:248:353; Interrogation_Position=1813; Antisense; GCAGCGGATCAGCAAGTTCACCTAC
>probe:Drosophila_2:1623148_at:395:671; Interrogation_Position=1835; Antisense; TACGCCATCTACCTATTGAATCCGA
>probe:Drosophila_2:1623148_at:98:601; Interrogation_Position=1861; Antisense; TGTAATCATGTACGTCTACCACTCC
>probe:Drosophila_2:1623148_at:191:497; Interrogation_Position=1874; Antisense; GTCTACCACTCCTTTAGCAATGAAG
>probe:Drosophila_2:1623148_at:543:601; Interrogation_Position=1899; Antisense; TGTATCCGGACAACACCATGATGAT
>probe:Drosophila_2:1623148_at:332:33; Interrogation_Position=1922; Antisense; ATAATGCTGGCTATCTCCTGTTCAG
>probe:Drosophila_2:1623148_at:67:533; Interrogation_Position=1948; Antisense; GGTCTGTTACCTTTGGGCCATAGTA
>probe:Drosophila_2:1623148_at:518:535; Interrogation_Position=1978; Antisense; GGTGCTCTTCGAGATTCCTTTCAAT
>probe:Drosophila_2:1623148_at:356:7; Interrogation_Position=1991; Antisense; ATTCCTTTCAATCGGCTGACCAGTG
>probe:Drosophila_2:1623148_at:552:461; Interrogation_Position=2020; Antisense; GATTAATTCTAGATCCTCTCCAGCA
>probe:Drosophila_2:1623148_at:274:641; Interrogation_Position=2064; Antisense; TCATCCCCGAAACCGACGAATATTT
>probe:Drosophila_2:1623148_at:537:9; Interrogation_Position=2173; Antisense; ATTCGCCGGCAATTGGTGTACTTTA
>probe:Drosophila_2:1623148_at:38:347; Interrogation_Position=2235; Antisense; GCATACACGAGTTGGTTTCCTCAAA

Paste this into a BLAST search page for me
AAGCCGGACAACAGCGACTCATATGGCAGCGGATCAGCAAGTTCACCTACTACGCCATCTACCTATTGAATCCGATGTAATCATGTACGTCTACCACTCCGTCTACCACTCCTTTAGCAATGAAGTGTATCCGGACAACACCATGATGATATAATGCTGGCTATCTCCTGTTCAGGGTCTGTTACCTTTGGGCCATAGTAGGTGCTCTTCGAGATTCCTTTCAATATTCCTTTCAATCGGCTGACCAGTGGATTAATTCTAGATCCTCTCCAGCATCATCCCCGAAACCGACGAATATTTATTCGCCGGCAATTGGTGTACTTTAGCATACACGAGTTGGTTTCCTCAAA

Full Affymetrix probeset data:

Annotations for 1623148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720