FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623149_at:

>probe:Drosophila_2:1623149_at:579:581; Interrogation_Position=1002; Antisense; TGGGATATTTTTTACGTAAGTGCAA
>probe:Drosophila_2:1623149_at:67:689; Interrogation_Position=1007; Antisense; TATTTTTTACGTAAGTGCAACTGCA
>probe:Drosophila_2:1623149_at:661:85; Interrogation_Position=1020; Antisense; AGTGCAACTGCAACTTACCTTTACG
>probe:Drosophila_2:1623149_at:356:615; Interrogation_Position=1022; Antisense; TGCAACTGCAACTTACCTTTACGAT
>probe:Drosophila_2:1623149_at:259:359; Interrogation_Position=1023; Antisense; GCAACTGCAACTTACCTTTACGATT
>probe:Drosophila_2:1623149_at:505:253; Interrogation_Position=1024; Antisense; CAACTGCAACTTACCTTTACGATTA
>probe:Drosophila_2:1623149_at:191:383; Interrogation_Position=1028; Antisense; TGCAACTTACCTTTACGATTAAGGG
>probe:Drosophila_2:1623149_at:443:567; Interrogation_Position=473; Antisense; GGCACAGTGTCTAAGCATCTCCCAA
>probe:Drosophila_2:1623149_at:24:155; Interrogation_Position=476; Antisense; ACAGTGTCTAAGCATCTCCCAATAT
>probe:Drosophila_2:1623149_at:719:83; Interrogation_Position=478; Antisense; AGTGTCTAAGCATCTCCCAATATCT
>probe:Drosophila_2:1623149_at:662:597; Interrogation_Position=480; Antisense; TGTCTAAGCATCTCCCAATATCTCC
>probe:Drosophila_2:1623149_at:694:207; Interrogation_Position=485; Antisense; AAGCATCTCCCAATATCTCCTACAG
>probe:Drosophila_2:1623149_at:174:243; Interrogation_Position=496; Antisense; AATATCTCCTACAGCCTCTCGGCGG
>probe:Drosophila_2:1623149_at:55:13; Interrogation_Position=499; Antisense; ATCTCCTACAGCCTCTCGGCGGTTG

Paste this into a BLAST search page for me
TGGGATATTTTTTACGTAAGTGCAATATTTTTTACGTAAGTGCAACTGCAAGTGCAACTGCAACTTACCTTTACGTGCAACTGCAACTTACCTTTACGATGCAACTGCAACTTACCTTTACGATTCAACTGCAACTTACCTTTACGATTATGCAACTTACCTTTACGATTAAGGGGGCACAGTGTCTAAGCATCTCCCAAACAGTGTCTAAGCATCTCCCAATATAGTGTCTAAGCATCTCCCAATATCTTGTCTAAGCATCTCCCAATATCTCCAAGCATCTCCCAATATCTCCTACAGAATATCTCCTACAGCCTCTCGGCGGATCTCCTACAGCCTCTCGGCGGTTG

Full Affymetrix probeset data:

Annotations for 1623149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720