FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623150_at:

>probe:Drosophila_2:1623150_at:652:647; Interrogation_Position=109; Antisense; TCACGTTTCGTGTCAAGAACCCAAG
>probe:Drosophila_2:1623150_at:162:179; Interrogation_Position=138; Antisense; AAACATGCGTTACGTGGCTGCTTAC
>probe:Drosophila_2:1623150_at:486:709; Interrogation_Position=164; Antisense; TTCTGGCCGTCCTCGGTGGCAAGGA
>probe:Drosophila_2:1623150_at:604:109; Interrogation_Position=212; Antisense; AGAAGATCCTCAGCTCTGTGGGCGT
>probe:Drosophila_2:1623150_at:285:135; Interrogation_Position=245; Antisense; ACGCCGAGCGTCTGACCAAGGTCAT
>probe:Drosophila_2:1623150_at:521:221; Interrogation_Position=262; Antisense; AAGGTCATCAAGGAGCTGGCTGGCA
>probe:Drosophila_2:1623150_at:699:213; Interrogation_Position=286; Antisense; AAGAGCATCGACGACCTGATCAAGG
>probe:Drosophila_2:1623150_at:245:435; Interrogation_Position=310; Antisense; GAGGGTCGCGAGAAGCTCTCCTCGA
>probe:Drosophila_2:1623150_at:502:51; Interrogation_Position=460; Antisense; ATGGGCTTCGCTCTCTTCGAATAAG
>probe:Drosophila_2:1623150_at:112:29; Interrogation_Position=503; Antisense; ATACTGTGCAACACACTTGCGAGGC
>probe:Drosophila_2:1623150_at:292:173; Interrogation_Position=531; Antisense; AAAGCAGCGTTCTGGAGCAGCCATT
>probe:Drosophila_2:1623150_at:619:317; Interrogation_Position=564; Antisense; GCCGGCCAGTCTACACACTTGTGTA
>probe:Drosophila_2:1623150_at:129:47; Interrogation_Position=595; Antisense; ATCCGTTCACCATTTCTACGTAATA
>probe:Drosophila_2:1623150_at:560:273; Interrogation_Position=97; Antisense; CATTTTGCCAATTCACGTTTCGTGT

Paste this into a BLAST search page for me
TCACGTTTCGTGTCAAGAACCCAAGAAACATGCGTTACGTGGCTGCTTACTTCTGGCCGTCCTCGGTGGCAAGGAAGAAGATCCTCAGCTCTGTGGGCGTACGCCGAGCGTCTGACCAAGGTCATAAGGTCATCAAGGAGCTGGCTGGCAAAGAGCATCGACGACCTGATCAAGGGAGGGTCGCGAGAAGCTCTCCTCGAATGGGCTTCGCTCTCTTCGAATAAGATACTGTGCAACACACTTGCGAGGCAAAGCAGCGTTCTGGAGCAGCCATTGCCGGCCAGTCTACACACTTGTGTAATCCGTTCACCATTTCTACGTAATACATTTTGCCAATTCACGTTTCGTGT

Full Affymetrix probeset data:

Annotations for 1623150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720