FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623155_at:

>probe:Drosophila_2:1623155_at:677:531; Interrogation_Position=100; Antisense; GGTGGCTCTGCATCAAGGGAAAGCA
>probe:Drosophila_2:1623155_at:617:527; Interrogation_Position=116; Antisense; GGGAAAGCACTAACTGCAACATCAA
>probe:Drosophila_2:1623155_at:472:443; Interrogation_Position=175; Antisense; GATGAGAAATCGCTGGCTTCCTGGC
>probe:Drosophila_2:1623155_at:267:287; Interrogation_Position=187; Antisense; CTGGCTTCCTGGCTTCATGAAGAAA
>probe:Drosophila_2:1623155_at:356:181; Interrogation_Position=236; Antisense; AAAACTTGTTCATCTTTGGCTCTAA
>probe:Drosophila_2:1623155_at:137:397; Interrogation_Position=283; Antisense; GACAAGCGGACAAGCAGCGGACCAA
>probe:Drosophila_2:1623155_at:631:201; Interrogation_Position=306; Antisense; AACCGAACTGATGGGCGGACATTCC
>probe:Drosophila_2:1623155_at:503:401; Interrogation_Position=323; Antisense; GACATTCCGGCGGACGGACGGACAA
>probe:Drosophila_2:1623155_at:74:75; Interrogation_Position=359; Antisense; AGGACAGCCGCACATTCTGCGATTG
>probe:Drosophila_2:1623155_at:603:517; Interrogation_Position=390; Antisense; GTGTGGCACATGTGGCACATACCGA
>probe:Drosophila_2:1623155_at:123:655; Interrogation_Position=44; Antisense; TAATTAAGCCGCCTCGCATGAGTGC
>probe:Drosophila_2:1623155_at:473:639; Interrogation_Position=448; Antisense; TCGGATTCGTCGTGGCCAGTAGCAA
>probe:Drosophila_2:1623155_at:273:43; Interrogation_Position=491; Antisense; ATCGAGACCAACTGGCAGCTGGCCG
>probe:Drosophila_2:1623155_at:600:297; Interrogation_Position=58; Antisense; CGCATGAGTGCTGTGTGGTTTTCCA

Paste this into a BLAST search page for me
GGTGGCTCTGCATCAAGGGAAAGCAGGGAAAGCACTAACTGCAACATCAAGATGAGAAATCGCTGGCTTCCTGGCCTGGCTTCCTGGCTTCATGAAGAAAAAAACTTGTTCATCTTTGGCTCTAAGACAAGCGGACAAGCAGCGGACCAAAACCGAACTGATGGGCGGACATTCCGACATTCCGGCGGACGGACGGACAAAGGACAGCCGCACATTCTGCGATTGGTGTGGCACATGTGGCACATACCGATAATTAAGCCGCCTCGCATGAGTGCTCGGATTCGTCGTGGCCAGTAGCAAATCGAGACCAACTGGCAGCTGGCCGCGCATGAGTGCTGTGTGGTTTTCCA

Full Affymetrix probeset data:

Annotations for 1623155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720