Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623158_s_at:

>probe:Drosophila_2:1623158_s_at:502:89; Interrogation_Position=13; Antisense; AGTAACGTAATTATGCCTTCCTCAT
>probe:Drosophila_2:1623158_s_at:146:151; Interrogation_Position=162; Antisense; ACATAGCCACGTAGCACATAAGAAT
>probe:Drosophila_2:1623158_s_at:444:311; Interrogation_Position=167; Antisense; GCCACGTAGCACATAAGAATTCTTT
>probe:Drosophila_2:1623158_s_at:543:291; Interrogation_Position=18; Antisense; CGTAATTATGCCTTCCTCATAATTC
>probe:Drosophila_2:1623158_s_at:299:109; Interrogation_Position=182; Antisense; AGAATTCTTTTTCATATGTATGCAC
>probe:Drosophila_2:1623158_s_at:729:115; Interrogation_Position=210; Antisense; AGCATAAGCAAGAAGCGCTCTCGCG
>probe:Drosophila_2:1623158_s_at:150:211; Interrogation_Position=215; Antisense; AAGCAAGAAGCGCTCTCGCGCAGAT
>probe:Drosophila_2:1623158_s_at:168:211; Interrogation_Position=219; Antisense; AAGAAGCGCTCTCGCGCAGATCAAG
>probe:Drosophila_2:1623158_s_at:575:123; Interrogation_Position=223; Antisense; AGCGCTCTCGCGCAGATCAAGTAAA
>probe:Drosophila_2:1623158_s_at:586:337; Interrogation_Position=226; Antisense; GCTCTCGCGCAGATCAAGTAAACAA
>probe:Drosophila_2:1623158_s_at:304:351; Interrogation_Position=234; Antisense; GCAGATCAAGTAAACAACCCACTAA
>probe:Drosophila_2:1623158_s_at:523:5; Interrogation_Position=310; Antisense; ATTCAATCAATAAAAACGCAAAGCG
>probe:Drosophila_2:1623158_s_at:409:275; Interrogation_Position=44; Antisense; CTTATACAAAAGACCGACCGCGGTG
>probe:Drosophila_2:1623158_s_at:462:43; Interrogation_Position=55; Antisense; GACCGACCGCGGTGGTCCGCCGTAT

Paste this into a BLAST search page for me
AGTAACGTAATTATGCCTTCCTCATACATAGCCACGTAGCACATAAGAATGCCACGTAGCACATAAGAATTCTTTCGTAATTATGCCTTCCTCATAATTCAGAATTCTTTTTCATATGTATGCACAGCATAAGCAAGAAGCGCTCTCGCGAAGCAAGAAGCGCTCTCGCGCAGATAAGAAGCGCTCTCGCGCAGATCAAGAGCGCTCTCGCGCAGATCAAGTAAAGCTCTCGCGCAGATCAAGTAAACAAGCAGATCAAGTAAACAACCCACTAAATTCAATCAATAAAAACGCAAAGCGCTTATACAAAAGACCGACCGCGGTGGACCGACCGCGGTGGTCCGCCGTAT

Full Affymetrix probeset data:

Annotations for 1623158_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime