FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623160_at:

>probe:Drosophila_2:1623160_at:89:395; Interrogation_Position=2565; Antisense; GAAATAGTTTATAACATTCCGCATT
>probe:Drosophila_2:1623160_at:397:9; Interrogation_Position=2580; Antisense; ATTCCGCATTCAAATCACAAAACGA
>probe:Drosophila_2:1623160_at:465:89; Interrogation_Position=2610; Antisense; AGTCATATCAAACCAGAAGTTCTCT
>probe:Drosophila_2:1623160_at:593:373; Interrogation_Position=2625; Antisense; GAAGTTCTCTACGTAGTTTTGCTGT
>probe:Drosophila_2:1623160_at:573:289; Interrogation_Position=2636; Antisense; CGTAGTTTTGCTGTTTTGGTAATGA
>probe:Drosophila_2:1623160_at:577:17; Interrogation_Position=2677; Antisense; ATTTAACGAGCCATATGCAAGGAAT
>probe:Drosophila_2:1623160_at:520:457; Interrogation_Position=2755; Antisense; GATATAATTGTTAATGTCGGCACAT
>probe:Drosophila_2:1623160_at:428:61; Interrogation_Position=2768; Antisense; ATGTCGGCACATGGGAAAGGAGCTC
>probe:Drosophila_2:1623160_at:535:593; Interrogation_Position=2779; Antisense; TGGGAAAGGAGCTCCGCATGCTCCT
>probe:Drosophila_2:1623160_at:459:51; Interrogation_Position=2796; Antisense; ATGCTCCTCCAGCTGTGCTACAATT
>probe:Drosophila_2:1623160_at:658:339; Interrogation_Position=2812; Antisense; GCTACAATTTCGCAAACTCAAGTGT
>probe:Drosophila_2:1623160_at:336:177; Interrogation_Position=2849; Antisense; AAACGATACGTGACTTGACCATATA
>probe:Drosophila_2:1623160_at:628:219; Interrogation_Position=2919; Antisense; AAGTGATATTTAAGACAGTCCATTA
>probe:Drosophila_2:1623160_at:358:399; Interrogation_Position=2932; Antisense; GACAGTCCATTAAACGATATTTTTT

Paste this into a BLAST search page for me
GAAATAGTTTATAACATTCCGCATTATTCCGCATTCAAATCACAAAACGAAGTCATATCAAACCAGAAGTTCTCTGAAGTTCTCTACGTAGTTTTGCTGTCGTAGTTTTGCTGTTTTGGTAATGAATTTAACGAGCCATATGCAAGGAATGATATAATTGTTAATGTCGGCACATATGTCGGCACATGGGAAAGGAGCTCTGGGAAAGGAGCTCCGCATGCTCCTATGCTCCTCCAGCTGTGCTACAATTGCTACAATTTCGCAAACTCAAGTGTAAACGATACGTGACTTGACCATATAAAGTGATATTTAAGACAGTCCATTAGACAGTCCATTAAACGATATTTTTT

Full Affymetrix probeset data:

Annotations for 1623160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720